Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NACA2-nascent polypeptide-associated complex alpha subunit 2 Gene
PTXBC062710
New product
Data sheet of NACA2-nascent polypeptide-associated complex alpha subunit 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NACA2-nascent polypeptide-associated complex alpha subunit 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062710 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NACA2 |
| Origin species: | Human |
| Product name: | NACA2-nascent polypeptide-associated complex alpha subunit 2 Gene |
| Size: | 2ug |
| Accessions: | BC062710 |
| Gene id: | 342538 |
| Gene description: | nascent polypeptide-associated complex alpha subunit 2 |
| Synonyms: | ANAC; NACAL; nascent polypeptide-associated complex subunit alpha-2; IgE autoantigen alpha-nascent polypeptide-associated complex; alpha-NAC protein; hom s 2.01 protein; nascent polypeptide-associated complex, alpha polypeptide, 2; nascent polypeptide associated complex alpha subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgggcgaagccacagaaaccgtccctgctacagagcaggagttgccgcagtcccaggctgagacagggtctggaacagcatctgatagtggtgaatcagtaccagggattgaagaacaggattccacccagaccaccacacaaaaagcctggctggtggcagcagctgaaattgatgaagaaccagtcggtaaagcaaaacagagtcggagtgaaaagagggcacggaaggctatgtccaaactgggtcttctacaggttacaggagttactagagtcactatctggaaatctaagaatatcctctttgtcatcacaaaactggacgtctacaagagccctgcttcggatgcctacatagtttttggggaagccaagatccaagatttatctcagcaagcacaactagcagctgcggagaaattcagagttcaaggtgaagctgtcggaaacattcaagaaaacacacagactccaactgtacaagaggagagtgaagaggaagaggtcgatgaaacaggtgtagaagttaaagacgtgaaattggtcatgtcacaagcaaatgtgtcgagagcaaaggcagtccgagctctgaagaacaacagtaatgatattgtaaatgcgattatggaattaacagtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 - guanine nucleotide binding protein (G protein), gamma 2 - cytochrome P450, family 2, subfamily E, polypeptide 1 - glycine cleavage system protein H (aminomethyl carrier) |