Login to display prices
Login to display prices
CYP3A7-cytochrome P450, family 3, subfamily A, polypeptide 7 Gene View larger

CYP3A7-cytochrome P450, family 3, subfamily A, polypeptide 7 Gene

PTXBC067436

New product

Data sheet of CYP3A7-cytochrome P450, family 3, subfamily A, polypeptide 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYP3A7-cytochrome P450, family 3, subfamily A, polypeptide 7 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC067436
Ncbi symbol: CYP3A7
Product name: CYP3A7-cytochrome P450, family 3, subfamily A, polypeptide 7 Gene
Size: 2ug
Accessions: BC067436
Gene id: 1551
Gene description: cytochrome P450, family 3, subfamily A, polypeptide 7
Synonyms: CP37; CYPIIIA7; P-450(HFL33); P-450111A7; P450-HFLA; cytochrome P450 3A7; aryl hydrocarbon hydroxylase; cytochrome P450, family 3, subfamily A, polypeptide 7; cytochrome P450, subfamily IIIA, polypeptide 7; cytochrome P450-HFLA; flavoprotein-linked monooxygenase; microsomal monooxygenase; xenobiotic monooxygenase; cytochrome P450 family 3 subfamily A member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatctcatcccaaacttggccgtggaaacctggcttctcctggctgtcagcctgatactcctctatctatatggaacccgtacacatggactttttaagaagcttggaattccagggcccacacctctgccttttttgggaaatgctttgtccttccgtaagggctattggacgtttgacatggaatgttataaaaagtatagaaaagtctggggtatttatgactgtcaacagcctatgctggctatcacagatcccgacatgatcaaaacagtgctagtgaaagaatgttattctgtcttcacaaaccggaggcctttcgggccagtgggatttatgaaaaatgccatctctatagctgaggatgaagaatggaagagaatacgatcattgctgtctccaacattcaccagcggaaaactcaaggagatggtccctatcattgcccagtatggagatgtgttggtgagaaatctgaggcgggaagcagagacaggcaagcctgtcaccttgaaacacgtctttggggcctacagcatggatgtgatcactagcacatcatttggagtgagcatcgactctctcaacaatccacaagacccctttgtggaaaacaccaagaagcttttaagatttaatccattagatccattcgttctctcaataaaagtctttccattccttaccccaattcttgaagcattaaatatcactgtgtttccaagaaaagttataagttttctaacaaaatctgtaaaacagataaaagaaggtcgcctcaaagagacacaaaagcaccgagtggatttccttcagctgatgattgactctcagaattcaaaagactctgagacccacaaagctctgtctgatctggagctcatggcccaatcaattatctttatttttgctggctatgaaaccacgagcagtgttctctctttcattatatatgaactggccactcaccctgatgtccagcagaaagtgcagaaggaaattgatacagttttacccaataaggcaccacccacctatgatactgtgctacagttggagtatcttgacatggtggtgaatgaaacactcagattattcccagttgctatgagacttgagagggtctgcaaaaaagatgttgaaatcaatgggatgtttattcccaaaggggtggtggtgatgattccaagctatgttcttcatcatgacccaaagtactggacagagcctgagaagttcctccctgaaaggttcagtaaaaagaacaaggacaacatagatccttacatatacacaccctttggaagtggacccagaaactgcattggcatgaggtttgctctcgtgaacatgaaacttgctctagtcagagtccttcagaacttctccttcaaaccttgtaaagaaacacagatccccctgaaattacgctttggaggacttcttctaacagaaaaacccattgttctaaaggctgagtcaagggatgagaccgtaagtggagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: