TMBIM4-transmembrane BAX inhibitor motif containing 4 Gene View larger

TMBIM4-transmembrane BAX inhibitor motif containing 4 Gene

PTXBC004401

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMBIM4-transmembrane BAX inhibitor motif containing 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMBIM4-transmembrane BAX inhibitor motif containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004401
Product type: DNA & cDNA
Ncbi symbol: TMBIM4
Origin species: Human
Product name: TMBIM4-transmembrane BAX inhibitor motif containing 4 Gene
Size: 2ug
Accessions: BC004401
Gene id: 51643
Gene description: transmembrane BAX inhibitor motif containing 4
Synonyms: CGI-119; GAAP; LFG4; S1R; ZPRO; protein lifeguard 4; Golgi anti-apoptotic protein; Z-protein; transmembrane BAX inhibitor motif-containing protein 4; transmembrane BAX inhibitor motif containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaccccgacccccggtaccctcgctcctcgatcgaggacgacttcaactatggcagcagcgtggcctccgccaccgtgcacatccgaatgggttctcttaactacagtgacttcaacagtttttttatactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - similar to Rho GTPase activating protein 15
- poly (ADP-ribose) polymerase family, member 16
- family with sequence similarity 13, member A1
- leucine-rich repeats and IQ motif containing 3

Buy TMBIM4-transmembrane BAX inhibitor motif containing 4 Gene now

Add to cart