Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM13A1-family with sequence similarity 13, member A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM13A1-family with sequence similarity 13, member A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063126 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM13A1 |
| Origin species: | Human |
| Product name: | FAM13A1-family with sequence similarity 13, member A1 Gene |
| Size: | 2ug |
| Accessions: | BC063126 |
| Gene id: | 10144 |
| Gene description: | family with sequence similarity 13, member A1 |
| Synonyms: | FAM13A1; ARHGAP48; protein FAM13A; FAM13A1_v2 protein; family with sequence similarity 13, member A1; family with sequence similarity 13 member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggcaggagctctagccatctgtcaaagtaaagcagcggttcggctgaaagaagacatgaaaaagatagtggcagtgccattaaatgaacagaaggattttacctatcagaagttatttggagtcagtctccaagaacttgaacggcaggggctcaccgagaatggcattccagcagtagtgtggaatatagtggaatatttgacgcagcatggacttacccaagaaggtctttttagggtgaatggtaacgtgaaggtggtggaacaacttcgactgaagttcgagagtggagtgcccgtggagctcgggaaggacggtgatgtctgctcagcagccagtctgttgaagctgtttctgagggagctgcctgacagtctgatcacctcagcgttgcagcctcgattcattcaactctttcaggatggcagaaatgatgttcaggagagtagcttaagagacttaataaaagagctgccagacacccactactgcctcctcaagtacctttgccagttcttgacaaaagtagccaagcatcatgtgcagaatcgcatgaatgttcacaatctcgccactgtatttgggccaaattgctttcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine-rich repeats and IQ motif containing 3 - zinc finger with UFM1-specific peptidase domain - family with sequence similarity 116, member B - dihydroxyacetone kinase 2 homolog (S. cerevisiae) |