No products
Prices are tax excluded
PTXBC080624
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC080624 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC440461 |
| Origin species: | Human |
| Product name: | LOC440461-similar to Rho GTPase activating protein 15 Gene |
| Size: | 2ug |
| Accessions: | BC080624 |
| Gene id: | 440461 |
| Gene description: | similar to Rho GTPase activating protein 15 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggcgtatgtggagggggatgtctacctggtggtggagcaccccttcgagtatacccgcaaggactggcgccgcgtggccatctggcccaatgagcgctactggctgctgcggcgcagcacggagcactggtggcacgtgcggcgcgagcctggcggccaccccttctacctgcccgcgcagtacgtgcgcgagctgcctgcgctgggcaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - poly (ADP-ribose) polymerase family, member 16 - family with sequence similarity 13, member A1 - leucine-rich repeats and IQ motif containing 3 - zinc finger with UFM1-specific peptidase domain |