Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SERF1A-small EDRK-rich factor 1A (telomeric) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERF1A-small EDRK-rich factor 1A (telomeric) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERF1A |
| Origin species: | Human |
| Product name: | SERF1A-small EDRK-rich factor 1A (telomeric) Gene |
| Size: | 2ug |
| Accessions: | BC035932 |
| Gene id: | 8293 |
| Gene description: | small EDRK-rich factor 1A (telomeric) |
| Synonyms: | 4F5; FAM2A; H4F5; SERF1; SMAM1; small EDRK-rich factor 1; SMA modifier 1; protein 4F5; small EDRK-rich factor 1A (telomeric); spinal muscular atrophy-related gene H4F5; small EDRK-rich factor 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgtggaaatcaacgagaacttgcccgccagaaaaacatgaagaaaacccaggaaattagcaagggaaagaggaaagaggatagcttgactgcctctcagagaaagcagagttctggaggccagaaatctgagagcaagatgtcagctgggccacacctccctctgaaggctccaagggagaatccttgctttcctcttccagctgctggtggctccaggtattacttggcttatggcagcataactcctatctctgcctttgtctttgtggtcttcttttctgtcttcttcccttctttttatgaggacttttgctgttggatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 124 - nicotinamide phosphoribosyltransferase - chromosome 11 open reading frame 63 - chromosome 17 open reading frame 42 |