C17orf42-chromosome 17 open reading frame 42 Gene View larger

C17orf42-chromosome 17 open reading frame 42 Gene

PTXBC024328

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf42-chromosome 17 open reading frame 42 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf42-chromosome 17 open reading frame 42 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024328
Product type: DNA & cDNA
Ncbi symbol: C17orf42
Origin species: Human
Product name: C17orf42-chromosome 17 open reading frame 42 Gene
Size: 2ug
Accessions: BC024328
Gene id: 79736
Gene description: chromosome 17 open reading frame 42
Synonyms: C17orf42; transcription elongation factor, mitochondrial; transcription elongation factor of mitochondria
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgggtctgtcctcttcacggcgggagagaggtggagatgctttctgaccccgtcgaggtcatccctgtactgggccttacataatttctgctgtcggaaaaaatccactacacctaagaaaattactcccaatgttactttttgtgatgataatgcaaaggagcccgaaaatgcacttgacaagctcttctcttcagaacagcaggcttccatcttgcatgtgttgaatacagcatctactaaagaacttgaagctttccgattgcttcgtggaagaaggtccatcaatatcgtagagcacagagaaaactttgggccatttcagaatttagagagtttaatgaatgtgcccttgtttaagtataaaagtacagttcaagtttgtaactccatactttgtccaaagactggacgggaaaaaagaaagtcaccggaaaaccggttcctgagaaagctcctcaaaccagacatagaaagagaaagacttaaggcagttaatagtatcatatctatcgtttttggtactcgaagaattgcctgggctcaccttgatcgtaagttgacagtgctggactggcagcaaagtgaccgttggagtttaatgagaggaatatactcatcatcagtctatttagaagaggtaaggcagttgcacctccagattcctacctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 6 open reading frame 162
- cell division cycle associated 7-like
- chromosome 21 open reading frame 88
- chromosome 20 open reading frame 70

Buy C17orf42-chromosome 17 open reading frame 42 Gene now

Add to cart