NAMPT-nicotinamide phosphoribosyltransferase Gene View larger

NAMPT-nicotinamide phosphoribosyltransferase Gene

PTXBC072439

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAMPT-nicotinamide phosphoribosyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAMPT-nicotinamide phosphoribosyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC072439
Product type: DNA & cDNA
Ncbi symbol: NAMPT
Origin species: Human
Product name: NAMPT-nicotinamide phosphoribosyltransferase Gene
Size: 2ug
Accessions: BC072439
Gene id: 10135
Gene description: nicotinamide phosphoribosyltransferase
Synonyms: 1110035O14Rik; PBEF; PBEF1; nicotinamide phosphoribosyltransferase; NAmPRTase; pre-B cell-enhancing factor; pre-B-cell colony-enhancing factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcctgcggcagaagccgagttcaacatcctcctggccaccgactcctacaaggttactcactataaacaatatccacccaacacaagcaaagtttattcctactttgaatgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagtattttatgggttgcagtacattcttaataagtacttaaaaggtaaagtagtaaccaaagagaaaatccaggaagccaaagatgtctacaaagaacatttccaagatgatgtctttaatgaaaagggatggaactacattcttgagaagtatgatgggcatcttccaatagaaataaaagctgttcctgagggctttgtcattcccagaggaaatgttctcttcacggtggaaaacacagatccagagtgttactggcttacaaattggattgagactattcttgttcagtcctggtatccaatcacagtggccacaaattctagagagcagaagaaaatattggccaaatatttgttagaaacttctggtaacttagatggtctggaatacaagttacatgattttggctacagaggagtctcttcccaagagactgctggcataggagcatctgctcacttggttaacttcaaaggaacagatacagtagcaggacttgctctaattaaaaaatattatggaacgaaagatcctgttccaggctattctgttccagcagcagaacacagtaccataacagcttgggggaaagaccatgaaaaagatgcttttgaacatattgtaacacagttttcatcagtgcctgtatctgtggtcagcgatagctatgacatttataatgcgtgtgagaaaatatggggtgaagatctaagacatttaatagtatcgagaagtacacaggcaccactaataatcagacctgattctggaaaccctcttgacactgtgttaaaggttttggagattttaggtaagaagtttcctgttactgagaactcaaagggttacaagttgctgccaccttatcttagagttattcaaggggatggagtagatattaataccttacaagagattgtagaaggcatgaaacaaaaaatgtggagtattgaaaatattgccttcggttctggtggaggtttgctacagaagttgacaagagatctcttgaattgttccttcaagtgtagctatgttgtaactaatggccttgggattaacgtcttcaaggacccagttgctgatcccaacaaaaggtccaaaaagggccgattatctttacataggacgccagcagggaattttgttacactggaggaaggaaaaggagaccttgaggaatatggtcaggatcttctccatactgtcttcaagaatggcaaggtgacaaaaagctattcatttgatgaaataagaaaaaatgcacagctgaatattgaactggaagcagcacatcattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 63
- chromosome 17 open reading frame 42
- chromosome 6 open reading frame 162
- cell division cycle associated 7-like

Buy NAMPT-nicotinamide phosphoribosyltransferase Gene now

Add to cart