Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of OXCT2-3-oxoacid CoA transferase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OXCT2-3-oxoacid CoA transferase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC072388 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OXCT2 |
| Origin species: | Human |
| Product name: | OXCT2-3-oxoacid CoA transferase 2 Gene |
| Size: | 2ug |
| Accessions: | BC072388 |
| Gene id: | 64064 |
| Gene description: | 3-oxoacid CoA transferase 2 |
| Synonyms: | FKSG25; SCOTT; succinyl-CoA:3-ketoacid coenzyme A transferase 2, mitochondrial; 3-oxoacid CoA-transferase 2A; testis-specific succinyl CoA:3-oxoacid CoA-transferase; 3-oxoacid CoA-transferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgctgcggctcctggcgtcagtgctcgggcgcggggtccccgccggcggctcagggctcgcgctgtcccagggctgcgcccgctgctttgccaccagtccccggccccgtgccaagttctacgcggacccggtggagatggtgaaggacatctctgacggggcgaccgtcatgatcgggggcttcgggctctgcgggatccccgagaacctgatcgccgcgctgctcaggacccgcgtgaaagacctgcaggtggtcagcagcaacgtgggcgtggaggacttcggcctgggcctcctgctggccgccaggcaggtccgtcgcatcgtctgttcctacgtgggcgagaacaccctgtgcgagagccagtacctggcaggagagctggagctggagctcacgccccagggcaccctggccgagcgcatccgcgcggggggcgccggggtgcccgccttctacacccccacgggctacgggaccctggtccaggaagggggcgcccccatccgctacaccccggacggccacctggcgctcatgagccagccccgagaggtgagggagttcaacggcgaccacttccttttggagcgcgccatccgggcagacttcgccctggtgaaagggtggaaggccgaccgggcaggaaacgtggtcttcaggagaagcgcccgcaatttcaacgtgcccatgtgcaaagctgcagacgtcacggcggtggaggtgggggcttccccccagaagacatccacgttcctaacatttatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aspartate dehydrogenase - leiomodin 1 (smooth muscle) - ataxia telangiectasia mutated - PWP1 homolog (S. cerevisiae) |