Cart 34 Product Products 6 063,95 € (empty)
-
-
-
1 x ICAM2-inte...121,50 € -
1 x MEST-mesod...121,50 € -
1 x COX4NB-COX...113,40 € -
1 x SERPINA12-...121,50 € -
-
1 x PTGR2-pros...121,50 € -
1 x METT5D1-me...113,40 € -
1 x Goat...419,00 € -
-
1 x BCAT2-bran...121,50 € -
1 x LILRA2-leu...121,50 € -
1 x BCAP29-B-c...113,40 € -
-
-
-
1 x LAMP1-lyso...121,50 € -
-
1 x ATG12-ATG1...113,40 € -
1 x INO80C-INO...113,40 € -
-
-
-
-
1 x C7orf11-ch...113,40 € -
-
-
1 x CSDC2-cold...113,40 € -
-
-
-
-
No products
To be determined Shipping
6 063,95 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 063,95 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 063,95 €
View larger 
Data sheet of ARHGAP11A-Rho GTPase activating protein 11A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP11A-Rho GTPase activating protein 11A Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC063444 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP11A |
| Origin species: | Human |
| Product name: | ARHGAP11A-Rho GTPase activating protein 11A Gene |
| Size: | 2ug |
| Accessions: | BC063444 |
| Gene id: | 9824 |
| Gene description: | Rho GTPase activating protein 11A |
| Synonyms: | GAP (1-12); rho GTPase-activating protein 11A; rho-type GTPase-activating protein 11A; Rho GTPase activating protein 11A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggatcagaggctggtgaggttggccctgttgcagcatctgcgggccttctatggtattaaggtgaagggtgtccgtgggcagtgcgatcgcaggagacatgaaacagcagccacggaaatagggggtaaaatatttggagtaccttttaatgcactgccccattctgctgtaccagaatatggacacattccaagctttcttgtcgatgcttgcacatctttagaagaccatattcataccgaagggctttttcggaaatcaggatctgtgattcgcctaaaagcactaaagaataaagtggatcatggtgaaggttgcctatcttctgcacctccttgtgatattgcgggacttcttaagcagttttttagggaactgccagagcccattctcccagctgatttgcatgaagcacttttgaaagctcaacagttaggcacagaggaaaagaataaagctacactgttgctctcctgtcttctggctgaccacacagttcatgtattaagatacttctttaactttctcaggaatgtttctcttagatccagtgagaataagatggacagcagcaatcttgcagtaatatttgcaccgaatcttcttcagacaagtgaaggacatgaaaagatgtcttctaacacagaaaagaagctacgattacaggctgcagtagtacagactcttatcgattatgcatcagatattgggcgtgtaccagattttatcctggaaaagataccagccatgttgggtattgatggtctctgtgctactccatcactggaaggctttgaagaaggtgaatatgaaactcctggtgaatataagagaaagagaagacaaagtgtaggagattttgttagtggagcactaaataaatttaaacctaacagaacaccttctattacacctcaagaagaaagaattgcccagctatctgaatcaccagtgattcttacaccaaatgctaagcgtacattgccagtagattcttctcatggtttctcaagtaagaaaaggaagtccatcaagcacaattttaactttgagctgttgccaagtaatctcttcaatagcagttctacaccggtatcagttcacatcgatacaagctcagaagggtcatctcagagttcactctctcctgtactcattggtggaaaccatttgatcactgcaggtgtgccaaggcgaagtaaaagaattgcaggcaaaaaagtttgcagagtggaatcaggaaaagcaggctgcttttctcctaaaatcagccataaagaaaaggttcgaagatctctgcgtttgaaattcaatctagggaaaaatggcagagaagtaaatggatgttctggtgtcaatagatatgaaagtgttggttggcgacttgcaaatcaacaaagtttaaaaaatcgaattgaatctgtaaaaacaggtttgctttttagcccagatgttgatgaaaagttaccaaagaaaggtacatttacatactactgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - receptor interacting protein kinase 5 - GrpE-like 2, mitochondrial (E. coli) - steroid 5 alpha-reductase 2-like 2 - coiled-coil domain containing 102B |