Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BSND-Bartter syndrome, infantile, with sensorineural deafness (Barttin) Gene
PTXBC069510
New product
Data sheet of BSND-Bartter syndrome, infantile, with sensorineural deafness (Barttin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BSND-Bartter syndrome, infantile, with sensorineural deafness (Barttin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069510 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BSND |
| Origin species: | Human |
| Product name: | BSND-Bartter syndrome, infantile, with sensorineural deafness (Barttin) Gene |
| Size: | 2ug |
| Accessions: | BC069510 |
| Gene id: | 7809 |
| Gene description: | Bartter syndrome, infantile, with sensorineural deafness (Barttin) |
| Synonyms: | BART; DFNB73; barttin; Bartter syndrome, infantile, with sensorineural deafness (Barttin); barttin CLCNK-type chloride channel accessory beta subunit; deafness, autosomal recessive 73; barttin CLCNK type accessory beta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgacgagaagaccttccggatcggcttcattgtgctggggcttttcctgctggccctcggtacgttcctcatgagccatgatcggccccaggtctacggcaccttctatgccatgggcagcgtcatggtgatcgggggcatcatctggagcatgtgccagtgctaccccaagatcaccttcgtccctgctgactctgactttcaaggcatcctctccccaaaggccatgggcctgctggagaatgggcttgctgccgagatgaagagccccagtccccagccgccctatgtaaggctgtgggaggaagccgcctatgaccagagcctgcctgacttcagccacatccagatgaaagtcatgagctacagtgaggaccaccgctccttgctggccctgagatggggcagccgaagctgggaaccagtgatggaggagaaggtggcctggcgacgttcaggcctggatggaggctgccgtggtcatccacaagggctcagacgagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic cation transporter), member 2 - neural precursor cell expressed, developmentally down-regulated 9 - PRP38 pre-mRNA processing factor 38 (yeast) domain containing B - acidic (leucine-rich) nuclear phosphoprotein 32 family, member B |