PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene View larger

PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC053838
Product type: DNA & cDNA
Ncbi symbol: PRPF38B
Origin species: Human
Product name: PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene
Size: 2ug
Accessions: BC053838
Gene id: 55119
Gene description: PRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms: NET1; pre-mRNA-splicing factor 38B; PRP38 pre-mRNA processing factor 38 domain containing B; sarcoma antigen NY-SAR-27; pre-mRNA processing factor 38B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctaacaacagccccgcgctgacaggcaactcgcagccgcagcaccaggcggctgcagctgcggctcagcaacagcagcagtgcggcggcggcggcgctaccaagccggcggtctccggcaagcagggcaatgtgctcccgctctggggcaacgagaagaccatgaacctcaaccccatgatcctgaccaacatcctgtcgtcgccttacttcaaagtacagctctacgagctcaagacctaccacgaggtggtggacgagatctactttaaggtcacgcacgttgaaccatgggagaaaggaagcaggaaaacagcgggccagacagggatgtgcggaggggttcgaggtgttggaacaggaggaattgtttctacagcattttgcctgttatacaaattatttaccctgaagttaactcgaaagcaagtgatgggtcttataacacacacagactctccatatattagagcgcttggatttatgtatataagatatacacagccccctacagatctgtgggactggtttgaatccttccttgatgatgaagagttcttcaccctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
- olfactory receptor, family 7, subfamily E, member 91 pseudogene
- neural precursor cell expressed, developmentally down-regulated 8
- glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial)

Buy PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene now

Add to cart