Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene
PTXBC053838
New product
Data sheet of PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053838 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRPF38B |
| Origin species: | Human |
| Product name: | PRPF38B-PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene |
| Size: | 2ug |
| Accessions: | BC053838 |
| Gene id: | 55119 |
| Gene description: | PRP38 pre-mRNA processing factor 38 (yeast) domain containing B |
| Synonyms: | NET1; pre-mRNA-splicing factor 38B; PRP38 pre-mRNA processing factor 38 domain containing B; sarcoma antigen NY-SAR-27; pre-mRNA processing factor 38B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaacaacagccccgcgctgacaggcaactcgcagccgcagcaccaggcggctgcagctgcggctcagcaacagcagcagtgcggcggcggcggcgctaccaagccggcggtctccggcaagcagggcaatgtgctcccgctctggggcaacgagaagaccatgaacctcaaccccatgatcctgaccaacatcctgtcgtcgccttacttcaaagtacagctctacgagctcaagacctaccacgaggtggtggacgagatctactttaaggtcacgcacgttgaaccatgggagaaaggaagcaggaaaacagcgggccagacagggatgtgcggaggggttcgaggtgttggaacaggaggaattgtttctacagcattttgcctgttatacaaattatttaccctgaagttaactcgaaagcaagtgatgggtcttataacacacacagactctccatatattagagcgcttggatttatgtatataagatatacacagccccctacagatctgtgggactggtttgaatccttccttgatgatgaagagttcttcaccctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acidic (leucine-rich) nuclear phosphoprotein 32 family, member B - olfactory receptor, family 7, subfamily E, member 91 pseudogene - neural precursor cell expressed, developmentally down-regulated 8 - glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) |