Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GATC-glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) Gene
PTXBC107145
New product
Data sheet of GATC-glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GATC-glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107145 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GATC |
| Origin species: | Human |
| Product name: | GATC-glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) Gene |
| Size: | 2ug |
| Accessions: | BC107145 |
| Gene id: | 283459 |
| Gene description: | glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) |
| Synonyms: | 15E1.2; glutamyl-tRNA(Gln) amidotransferase subunit C, mitochondrial; glu-AdT subunit C; glutamyl-tRNA(Gln) amidotransferase, subunit C homolog; glutamyl-tRNA amidotransferase subunit C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggtcgcggttggtgtggctgggccttcgggcccctctgggcgggcgccagggcttcacctccaaggcggatcctcagggcagtggccggatcacggctgcggtgatcgagcacctggagcgtctagcgcttgtggacttcggcagccgcgaggcagtggcgcgactggagaaagctatcgccttcgccgaccggctacgcgccgtggacacagacggggtggagcccatggaatcggtcctggaggacagatgtctatacctgagatccgacaatgtggtagaaggcaactgtgctgatgaattactacaaaactcccatcgcgtcgtggaggagtactttgtggcccccccaggtaatatctctttgccaaagctggatgaacaagagccattcccacacagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholysine phosphohistidine inorganic pyrophosphate phosphatase - RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) - potassium voltage-gated channel, Shal-related subfamily, member 3 - potassium voltage-gated channel, Shal-related subfamily, member 2 |