Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene
PTXBC020686
New product
Data sheet of NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020686 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NEDD9 |
| Origin species: | Human |
| Product name: | NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene |
| Size: | 2ug |
| Accessions: | BC020686 |
| Gene id: | 4739 |
| Gene description: | neural precursor cell expressed, developmentally down-regulated 9 |
| Synonyms: | CAS-L; CAS2; CASL; CASS2; HEF1; enhancer of filamentation 1; Cas scaffolding protein family member 2; Crk-associated substrate related protein Cas-L; Enhancer of filamentation 1 p55; cas-like docking; neural precursor cell expressed developmentally down-regulated protein 9; p130Cas-related protein; renal carcinoma antigen NY-REN-12; neural precursor cell expressed, developmentally down-regulated 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtataagaatcttatggcaagggccttatatgacaatgtcccagagtgtgccgaggaactggcctttcgcaagggagacatcctgaccgtcatagagcagaacacagggggactggaaggatggtggctgtgctcgttacacggtcggcaaggcattgtcccaggcaaccgggtgaagcttctgattggtcccatgcaggagactgcctccagtcacgagcagcctgcctctggactgatgcagcagacctttggccaacagaagctctatcaagtgccaaacccacaggctgctccccgagacaccatctaccaagtgccaccttcctaccaaaatcagggaatttaccaagtccccactggccacggcacccaagaacaagaggtatatcaggtgccaccatcagtgcagagaagcattgggggaaccagtgggccccacgtgggtaaaaaggtgttccagagagatgggcaagtgtcctatttcttagtgagagcctctaaacaaaccagcttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PRP38 pre-mRNA processing factor 38 (yeast) domain containing B - acidic (leucine-rich) nuclear phosphoprotein 32 family, member B - olfactory receptor, family 7, subfamily E, member 91 pseudogene - neural precursor cell expressed, developmentally down-regulated 8 |