NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene View larger

NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020686
Product type: DNA & cDNA
Ncbi symbol: NEDD9
Origin species: Human
Product name: NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene
Size: 2ug
Accessions: BC020686
Gene id: 4739
Gene description: neural precursor cell expressed, developmentally down-regulated 9
Synonyms: CAS-L; CAS2; CASL; CASS2; HEF1; enhancer of filamentation 1; Cas scaffolding protein family member 2; Crk-associated substrate related protein Cas-L; Enhancer of filamentation 1 p55; cas-like docking; neural precursor cell expressed developmentally down-regulated protein 9; p130Cas-related protein; renal carcinoma antigen NY-REN-12; neural precursor cell expressed, developmentally down-regulated 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtataagaatcttatggcaagggccttatatgacaatgtcccagagtgtgccgaggaactggcctttcgcaagggagacatcctgaccgtcatagagcagaacacagggggactggaaggatggtggctgtgctcgttacacggtcggcaaggcattgtcccaggcaaccgggtgaagcttctgattggtcccatgcaggagactgcctccagtcacgagcagcctgcctctggactgatgcagcagacctttggccaacagaagctctatcaagtgccaaacccacaggctgctccccgagacaccatctaccaagtgccaccttcctaccaaaatcagggaatttaccaagtccccactggccacggcacccaagaacaagaggtatatcaggtgccaccatcagtgcagagaagcattgggggaaccagtgggccccacgtgggtaaaaaggtgttccagagagatgggcaagtgtcctatttcttagtgagagcctctaaacaaaccagcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRP38 pre-mRNA processing factor 38 (yeast) domain containing B
- acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
- olfactory receptor, family 7, subfamily E, member 91 pseudogene
- neural precursor cell expressed, developmentally down-regulated 8

Buy NEDD9-neural precursor cell expressed, developmentally down-regulated 9 Gene now

Add to cart