PTXBC069312
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069312 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LGALS13 |
| Origin species: | Human |
| Product name: | LGALS13-lectin, galactoside-binding, soluble, 13 Gene |
| Size: | 2ug |
| Accessions: | BC069312 |
| Gene id: | 29124 |
| Gene description: | lectin, galactoside-binding, soluble, 13 |
| Synonyms: | GAL13; PLAC8; PP13; galactoside-binding soluble lectin 13; beta-galactoside-binding lectin; gal-13; lectin, galactoside-binding, soluble, 13; placental protein 13; placental tissue protein 13; galectin 13 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttctttacccgtgccatacaaactgcctgtgtctttgtctgttggttcctgcgtgataatcaaagggacaccaatccactcttttatcaatgacccacagctgcaggtggatttctacactgacatggatgaggattcagatattgccttccgtttccgagtgcactttggcaatcatgtggtcatgaacaggcgtgagtttgggatatggatgttggaggagacaacagactacgtgccctttgaggatggcaaacaatttgagctgtgcatctacgtacattacaatgagtatgagataaaggtcaatggcatacgcatttacggctttgtccatcgaatcccgccatcatttgtgaagatggtgcaagtgtcgagagatatctccctgacctcagtgtgtgtctgcaattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - diffuse panbronchiolitis critical region 1 - CAP-GLY domain containing linker protein 1 - C-type lectin domain family 10, member A - cytochrome c oxidase subunit IV isoform 1 |