Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of COX4I1-cytochrome c oxidase subunit IV isoform 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX4I1-cytochrome c oxidase subunit IV isoform 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047869 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX4I1 |
| Origin species: | Human |
| Product name: | COX4I1-cytochrome c oxidase subunit IV isoform 1 Gene |
| Size: | 2ug |
| Accessions: | BC047869 |
| Gene id: | 1327 |
| Gene description: | cytochrome c oxidase subunit IV isoform 1 |
| Synonyms: | COX IV-1; COX4; COX4-1; COXIV; COXIV-1; cytochrome c oxidase subunit 4 isoform 1, mitochondrial; cytochrome c oxidase polypeptide IV; cytochrome c oxidase subunit IV; cytochrome c oxidase subunit 4I1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttggctaccagggtatttagcctagttggcaagcgagcaatttccacctctgtgtgtgtacgagctcatgaaagtgttgtgaagagcgaagacttttcgctcccagcttatatggatcggcgtgaccaccccttgccggaggtggcccatgtcaagcacctgtctgccagccagaaggcactgaaggagaaggagaaggcctcctggagcagcctctccatggatgagaaagtcgagtgtgggtattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - enhancer of polycomb homolog 1 (Drosophila) - FERM and PDZ domain containing 2 like 2 - discoidin domain receptor tyrosine kinase 1 - AT rich interactive domain 5A (MRF1-like) |