Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CLIP1-CAP-GLY domain containing linker protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLIP1-CAP-GLY domain containing linker protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039081 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLIP1 |
| Origin species: | Human |
| Product name: | CLIP1-CAP-GLY domain containing linker protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC039081 |
| Gene id: | 6249 |
| Gene description: | CAP-GLY domain containing linker protein 1 |
| Synonyms: | CLIP; CLIP-170; CLIP170; CYLN1; RSN; CAP-Gly domain-containing linker protein 1; cytoplasmic linker protein 1; cytoplasmic linker protein 170 alpha-2; cytoplasmic linker protein CLIP-170; restin (Reed-Steinberg cell-expressed intermediate filament-associated protein); CAP-Gly domain containing linker protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtatgctaaagccaagtgggcttaaggcccccaccaagatcctgaagcctggaagcacagctctgaagacacctacggctgttgtagctccagtagaaaaaaccatatccagtgaaaaagcatcaagcactccatcatctgagactcaggaggaatttgtggatgactttcgagttggggagcgagtttgggtgaatggaaataagcctggatttatccagtttcttggagaaacccagtttgcaccaggccagtgggctggaattgttttagatgaacccataggcaagaacgatggttcggtggcaggagttcggtatttccagtgtgaacctttaaagggcatatttacccgaccttcaaagttaacaaggaaggtgcaagcagaagatgaagctaatggcctgcagacaacgcccgcctcccgagctacttcaccgctgtgcacttctacggccagcatggtgtcttcctccccctccaccccttcaaacatccctcagaaaccatcacagccagcagcaaaggaaccttcagctacgcctccgatcagcaaccttacaaaaactgccagtgaatctatctccaacctttcagaggctggctcaatcaagaaaggagaaagagagctcaaaatcggagacagagtattggttggtggcactaaggctggtgtagtccggtttcttggggagaccgactttgccaagggggagtggtgtggcgtggagttagatgagccacttgggaagaatgatggcgctgttgctggaacaaggtattttcagtgtcaacccaaatatggcttgttcgctcctgtccacaaagttaccaagattggcttcccttccactacaccagccaaagccaaggccaacgcagtgaggcgagtgatggcgaccacgtccgccagcctgaagcgcagcccttctgcctcttccctcagctccatgagctcagtggcctcctctgtgagcagcaggcccagtcggacaggactagtaaggcccctttctcactacctgcctccacttcccaggcaggattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 10, member A - cytochrome c oxidase subunit IV isoform 1 - enhancer of polycomb homolog 1 (Drosophila) - FERM and PDZ domain containing 2 like 2 |