ZBTB46-zinc finger and BTB domain containing 46 Gene View larger

ZBTB46-zinc finger and BTB domain containing 46 Gene


New product

Data sheet of ZBTB46-zinc finger and BTB domain containing 46 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZBTB46-zinc finger and BTB domain containing 46 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC052269
Product type: DNA & cDNA
Ncbi symbol: ZBTB46
Origin species: Human
Product name: ZBTB46-zinc finger and BTB domain containing 46 Gene
Size: 2ug
Accessions: BC052269
Gene id: 140685
Gene description: zinc finger and BTB domain containing 46
Synonyms: BTBD4; BZEL; RINZF; ZNF340; dJ583P15.7; dJ583P15.8; zinc finger and BTB domain-containing protein 46; BTB (POZ) domain containing 4; BTB-ZF protein expressed in effector lymphocytes; BTB/POZ domain-containing protein 4; zinc finger protein 340; zinc finger and BTB domain containing 46
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaaccgaaaggaagatatggaaatcgcgtcccactaccggcacctgctgcgggagctcaacgagcagaggcagcacggcgtcctgtgcgacgtctgcgtggtcgtggagggcaaggtcttcaaggcgcacaagaacgtcctgctgggcagcagccgctacttcaagacgctctactgccaggtgcagaagacgtcggagcaggccacggtcacgcacctggacatcgtcacggcccagggcttcaaggccatcatcgacttcatgtactcagcgcacctggcgctcaccagcaggaacgtcatcgaggtgatgtcagccgccagcttcctgcagatgacggacatcgtgcaagcctgccacgacttcatcaaggcggcgctggacatcagcatcaagtcggacgcctcagatgagcttgcggagttcgagatcggcgcctcgtccagcagcagcacggaagctctcatctcggccgtgatggccgggaggagcatctccccgtggctggcacggcgaacgagtcctgccaattcttccggagactcggccatcgccagctgtcacgacggagggagcagctacgggaaagaggatcaggagcccaaggccgatggccctgatgatgtttcttcacagcctctatggcctggagacgtgggctacgggcctctgcgcatcaaggaagagcaggtttcaccgtctcagtacggagggagcgagctgccttctgccaaggacggtgcagtacagaactctttctcagagcagagtgctggtgatgcctggcagcccacgggccgaaggaagaatcggaaaaacaaagagaccgtccggcacatcacacagcaggtggaagatgacagccgggccagctccccggtgccgtccttcctgccgacgtcggggtggccgttcagcagccgagactcaaatgcggacctgtccgtcaccgaagccagcagctccgacagccgaggagagagggccgagctctatgcacaggtggaggagggtctcctgggaggagaagccagctatctgggccctcccctcaccccagagaaggacgacgccctgcatcaggccaccgcggtggccaacctgcgcgcggcgctcatgagtaagaacagcctgctgtcgctgaaggccgacgtgctgggggatgacggctccctgctgttcgagtacctgcccagaggggcccactcgctgtccctgaatgagttcacggtgatcaggaagaagttcaagtgtccgtactgcagcttctcggccatgcaccagtgcatcctcaagcgacacatgcgctcgcacacgggagagcggccctacccctgcgagatctgcgggaagaagttcacgcggcgcgagcacatgaagcgccacacgctggtccacagcaaggacaagaagtatgtgtgcaaggtgtgcagccgcgtcttcatgtccgccgccagcgtgggcatcaggcatggctccaggcgccacggtgtgtgcaccgactgtgctggccgcggcatggccgggcccctggaccatggcggcggaggcggcgagggctctccagaggcgctgttcccaggcgacgggccctatctggaggaccctgaggacccacgaggggaggcggaggagctgggcgaggacgacgagggcctggcccctgaggatgcgctgttggcggacgacaaggatgaggaagactcgccgcggccgcgcagccccccaggaggccctgacaaggacttcgcctggctctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - progestagen-associated endometrial protein
- p21 protein (Cdc42/Rac)-activated kinase 2
- A kinase (PRKA) anchor protein (yotiao) 9
- LIM homeobox transcription factor 1, beta

Buy ZBTB46-zinc finger and BTB domain containing 46 Gene now

Add to cart