Cart 6 Product Products 1 712,97 € (empty)
-
1 x CCDC67-coi...121,50 € -
-
1 x LOC554202-...113,40 € -
-
-
No products
To be determined Shipping
1 712,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 712,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 712,97 €
View larger 
Data sheet of PAEP-progestagen-associated endometrial protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAEP-progestagen-associated endometrial protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069451 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAEP |
| Origin species: | Human |
| Product name: | PAEP-progestagen-associated endometrial protein Gene |
| Size: | 2ug |
| Accessions: | BC069451 |
| Gene id: | 5047 |
| Gene description: | progestagen-associated endometrial protein |
| Synonyms: | GdA; GdF; GdS; PAEG; PEP; PP14; glycodelin; PEG; PP14 protein (placental protein 14); alpha uterine protein; glycodelin-A; glycodelin-F; glycodelin-S; placental protein 14; pregnancy-associated endometrial alpha-2 globulin; progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial a; progesterone-associated endometrial protein; progestagen associated endometrial protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggtccacatcacctcactgttgcccacccccgaggacaacctggagatcgttctgcacagatgggagaacaacagctgtgttgagaagaaggtccttggagagaagactgagaatccaaagaagttcaagatcaactatacggtggcgaacgaggccacgctgctcgatactgactacgacaatttcctgtttctctgcctacaggacaccaccacccccatccagagcatgatgtgccagtacctggccagagtcctggtggaggacgatgagatcatgcagggattcatcagggctttcaggcccctgcccaggcacctatggtacttgctggacttgaaacagatggaagagccgtgccgtttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - p21 protein (Cdc42/Rac)-activated kinase 2 - A kinase (PRKA) anchor protein (yotiao) 9 - LIM homeobox transcription factor 1, beta - zinc finger and SCAN domain containing 1 |