Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AKAP9-A kinase (PRKA) anchor protein (yotiao) 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKAP9-A kinase (PRKA) anchor protein (yotiao) 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015533 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKAP9 |
| Origin species: | Human |
| Product name: | AKAP9-A kinase (PRKA) anchor protein (yotiao) 9 Gene |
| Size: | 2ug |
| Accessions: | BC015533 |
| Gene id: | 10142 |
| Gene description: | A kinase (PRKA) anchor protein (yotiao) 9 |
| Synonyms: | AKAP9-BRAF fusion protein; AKAP-9; AKAP350; AKAP450; CG-NAP; HYPERION; LQT11; MU-RMS-40.16A; PPP1R45; PRKA9; YOTIAO; A-kinase anchor protein 9; A kinase (PRKA) anchor protein (yotiao) 9; A kinase (PRKA) anchor protein 9; A-kinase anchor protein 350 kDa; A-kinase anchor protein 450 kDa; AKAP 120-like protein; centrosome- and Golgi-localized PKN-associated protein; centrosome- and golgi-localized protein kinase N-associated protein; kinase N-associated protein; protein hyperion; protein kinase A anchoring protein 9; protein phosphatase 1, regulatory subunit 45; protein yotiao; A-kinase anchoring protein 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggacgaggagagacagaagaagctggaggccggcaaagccaagcttgcccagtttcgacaaagaaaagctcagtcggatgggcagagtccttccaagaagcagaaaaaaaagagaaaaacgtcaagcagtaaacatgatgtgtcagcacaccatgatttgaatattgatcaatcacagtgtaatgaaatgtacataaatagttctcagagagtagaatcaactgtgattcctgaatctacaataatgagaactctacatagtggagaaataaccagtcatgagcagggcttctctgtggaactggaaagtgaaatttcaaccacagcagatgactgcagttcagaggtaaatggttgcagttttgtgatgagaacaggaaagcctacaaatttattaagggaagaagaatttggtgttgatgattcttattctgaacaaggagcacaagacagtccgactcatctagagatgatggaaagtgagttggctgggaagcagcatgagattgaagagctaaacagagagctggaagaaatgagggttacctatgggactgaaggactgcagcagttacaagaatttgaagctgccattaaacaaagagatggcattataacccagctcactgctaatttacaacaagcaagaagagaaaaggatgagacaatgagagaatttttagagttgacagaacagagtcaaaaattacagattcaatttcagcaattacaggctagtgaaactctgagaaacagcactcatagtagcacagctgcagacttactacaagccaaacaacagatcctcactcatcaacagcagcttgaagaacaagaccacttattagaagattatcagaaaaagaaagaagacttcacaatgcaaattagtttcttgcaagagaaaattaaagtatatgaaatggtatgtttattttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LIM homeobox transcription factor 1, beta - zinc finger and SCAN domain containing 1 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 - golgi autoantigen, golgin subfamily a, 4 |