UBR2-ubiquitin protein ligase E3 component n-recognin 2 Gene View larger

UBR2-ubiquitin protein ligase E3 component n-recognin 2 Gene

PTXBC064512

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBR2-ubiquitin protein ligase E3 component n-recognin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBR2-ubiquitin protein ligase E3 component n-recognin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC064512
Product type: DNA & cDNA
Ncbi symbol: UBR2
Origin species: Human
Product name: UBR2-ubiquitin protein ligase E3 component n-recognin 2 Gene
Size: 2ug
Accessions: BC064512
Gene id: 23304
Gene description: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: E3 ubiquitin-protein ligase UBR2; C6orf133; bA49A4.1; dJ242G1.1; dJ392M17.3; ubiquitin-protein ligase E3-alpha-2; ubiquitin-protein ligase E3-alpha-II; ubiquitin protein ligase E3 component n-recognin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcggagctagagccagaggtgcaggccatcgaccggagcttgctggaatgttcggccgaggagattgcggggaaatggctgcaagcaactgacctcactagagaagtgtaccagcatttagcccactatgtacccaaaatctactgcaggggtcccaacccttttccacagaaagaagacatgctggcacagcatgttttgttgggaccaatggaatggtacctttgtggtgaagatcctgcatttggatttccaaaacttgagcaagcaaacaaaccttctcatctttgtggtcgtgtttttaaagtaggagagcctacatattcttgcagagactgtgcagttgatccaacttgtgttttgtgcatggagtgctttttgggaagtattcacagagatcatcgatataggatgacaacatcaggaggtggaggtttctgtgactgtggtgatactgaagcctggaaagagggtccttactgtcaaaaacatgaacttaacacctctgaaattgaggaagaagaggatcctcttgttcatttatcagaagatgtgatagcaagaacttataacatttttgctattacgtttcggtatgcagtagaaatattaacctgggaaaaagaaagtgaattgccagcagatttagagatggtagagaagagtgacacctactattgcatgctgtttaatgatgaggttcacacctacgaacaagttatttatactcttcagaaagctgttaactgtacacaaaaagaagctattggttttgcaactacagtagatcgagatgggcgtaggtctgttcgatatggagattttcagtattgtgagcaagcaaaatcagtaattgtgagaaataccagtagacagacaaagccactcaaagttcaagttatgcattcgtctattgtcgcacatcagaattttggtttgaaacttttgtcttggctgggaagtattattggatattcagatggccttcgccggattttatgtcaagttggtttacaagaagggccagatggtgaaaactcttctctagtggacagactgatgcttagtgattccaaattatggaaaggtgctaggagtgtatatcatcagttgttcatgagcagtctgcttatggatttgaaatacaagaaactatttgctgttcgatttgcaaaaaactatgagcgtttgcagagtgattatgtgacagatgaccacgacagagagttttcagtcgcagacctctcggttcagatattcacggttccttcacttttctctatctctgctgggcgcagtggctcacctctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - group-specific component (vitamin D binding protein)
- family with sequence similarity 114, member A1
- caspase 14, apoptosis-related cysteine peptidase
- interleukin 3 (colony-stimulating factor, multiple)

Buy UBR2-ubiquitin protein ligase E3 component n-recognin 2 Gene now

Add to cart