Login to display prices
Login to display prices
GC-group-specific component (vitamin D binding protein) Gene View larger

GC-group-specific component (vitamin D binding protein) Gene

PTXBC057228

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GC-group-specific component (vitamin D binding protein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GC-group-specific component (vitamin D binding protein) Gene

Proteogenix catalog: PTXBC057228
Ncbi symbol: GC
Product name: GC-group-specific component (vitamin D binding protein) Gene
Size: 2ug
Accessions: BC057228
Gene id: 2638
Gene description: group-specific component (vitamin D binding protein)
Synonyms: GC, vitamin D binding protein; gc-globulin; gc protein-derived macrophage activating factor; Gc-MAF; DBP/GC; DBP; GRD3; GcMAF; HEL-S-51; VDBG; VDBP; vitamin D-binding protein; DBP-maf; VDB; epididymis secretory protein Li 51; group-specific component (vitamin D binding protein); vitamin D-binding alpha-globulin; vitamin D-binding protein-macrophage activating factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagggtcctggtactactgcttgctgtggcatttggacatgctttagagagaggccgggattatgaaaagaataaagtctgcaaggaattctcccatctgggaaaggaggacttcacatctctgtcactagtcctgtacagtagaaaatttcccagtggcacgtttgaacaggtcagccaacttgtgaaggaagttgtctccttgaccgaagcctgctgtgcggaaggggctgaccctgactgctatgacaccaggacctcagcactgtctgccaagtcctgtgaaagtaattctccattccccgttcacccaggcactgctgagtgctgcaccaaagagggcctggaacgaaagctctgcatggctgctctgaaacaccagccacaggaattccctacctacgtggaacccacaaatgatgaaatctgtgaggcgttcaggaaagatccaaaggaatatgctaatcaatttatgtgggaatattccactaattacggacaagctcctctgtcacttttagtcagttacaccaagagttatctttctatggtagggtcctgctgtacctctgcaagcccaactgtatgctttttgaaagagagactccagcttaaacatttatcacttctcaccactctgtcaaatagagtctgctcacaatatgctgcttatggggagaagaaatcaaggctcagcaatctcataaagttagcccaaaaagtgcctactgctgatctggaggatgttttgccactagctgaagatattactaacatcctctccaaatgctgtgagtctgcctctgaagattgcatggccaaagagctgcctgaacacacagtaaaactctgtgacaatttatccacaaagaattctaagtttgaagactgttgtcaagaaaaaacagccatggacgtttttgtgtgcacttacttcatgccagctgcccaactccccgagcttccagatgtagagttgcccacaaacaaagatgtgtgtgatccaggaaacaccaaagtcatggataagtatacatttgaactaagcagaaggactcatcttccggaagtattcctcagtaaggtacttgagccaaccctaaaaagccttggtgaatgctgtgatgttgaagactcaactacctgttttaatgctaagggccctctactaaagaaggaactatcttctttcattgacaagggacaagaactatgtgcagattattcagaaaatacatttactgagtacaagaaaaaactggcagagcgactaaaagcaaaattgcctgatgccacacccacggaactggcaaagctggttaacaagcgctcagactttgcctccaactgctgttccataaactcacctcctctttactgtgattcagagattgatgctgaattgaagaatatcctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: