Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IL3-interleukin 3 (colony-stimulating factor, multiple) Gene
PTXBC069472
New product
Data sheet of IL3-interleukin 3 (colony-stimulating factor, multiple) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL3-interleukin 3 (colony-stimulating factor, multiple) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069472 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL3 |
| Origin species: | Human |
| Product name: | IL3-interleukin 3 (colony-stimulating factor, multiple) Gene |
| Size: | 2ug |
| Accessions: | BC069472 |
| Gene id: | 3562 |
| Gene description: | interleukin 3 (colony-stimulating factor, multiple) |
| Synonyms: | IL-3; MCGF; MULTI-CSF; interleukin-3; P-cell stimulating factor; colony-stimulating factor, multiple; hematopoietic growth factor; mast-cell growth factor; multilineage-colony-stimulating factor; multipotential colony-stimulating factor; interleukin 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccgcctgcccgtcctgctcctgctccaactcctggtccgccccggactccaagctcccatgacccagacaacgcccttgaagacaagctgggttaactgctctaacatgatcgatgaaattataacacacttaaagcagccacctttgcctttgctggacttcaacaacctcaatggggaagaccaagacattctgatggaaaataaccttcgaaggccaaacctggaggcattcaacagggctgtcaagagtttacagaacgcatcagcaattgagagcattcttaaaaatctcctgccatgtctgcccctggccacggccgcacccacgcgacatccaatccatatcaaggacggtgactggaatgaattccggaggaaactgacgttctatctgaaaacccttgagaatgcgcaggctcaacagacgactttgagcctcgcgatcttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein tyrosine phosphatase, non-receptor type 2 - small nuclear ribonucleoprotein 35kDa (U11/U12) - v-mos Moloney murine sarcoma viral oncogene homolog - N-acyl phosphatidylethanolamine phospholipase D |