Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MOS-v-mos Moloney murine sarcoma viral oncogene homolog Gene
PTXBC069569
New product
Data sheet of MOS-v-mos Moloney murine sarcoma viral oncogene homolog Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MOS-v-mos Moloney murine sarcoma viral oncogene homolog Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069569 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MOS |
| Origin species: | Human |
| Product name: | MOS-v-mos Moloney murine sarcoma viral oncogene homolog Gene |
| Size: | 2ug |
| Accessions: | BC069569 |
| Gene id: | 4342 |
| Gene description: | v-mos Moloney murine sarcoma viral oncogene homolog |
| Synonyms: | MOS proto-oncogene, serine/threonine kinase; v-mos Moloney murine sarcoma viral oncogene homolog; proto-oncogene c-Mos; oocyte maturation factor mos; oncogene MOS, Moloney murine sarcoma virus; c-mos; proto-oncogene serine/threonine-protein kinase mos; MSV |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctcgcccctggccctacgcccctacctccggagcgagttttccccatcggtggacgcgcggccctgcagcagtccctcagagctacctgcgaagctgcttctgggggccactcttcctcgggccccgcggctgccgcgccggctggcctggtgctccattgactgggagcaggtgtgcttgctgcagaggctgggagctggagggtttggctcggtgtacaaggcgacttaccgcggtgttcctgtggccataaagcaagtgaacaagtgcaccaagaaccgactagcatctcggcggagtttctgggctgagctcaacgtagcaaggctgcgccacgataacatcgtgcgcgtggtggctgccagcacgcgcacgcccgcagggtccaatagcctagggaccatcatcatggagttcggtggcaacgtcactttacaccaagtcatctatggcgccgccggccaccctgagggggacgcaggggagcctcactgccgcactggaggacagttaagtttgggaaagtgtctcaagtactcactagatgttgtgaacggcctgctcttcctccactcgcaaagcattgtgcacttggacctgaagcccgcgaacatcttgatcagtgagcaggatgtctgtaaaattagtgacttcggttgctctgagaagttggaagatctgctgtgcttccagacaccctcttaccctctaggaggcacatacacccaccgcgccccggagctcctgaaaggagagggcgtgacgcctaaagccgacatttattcctttgccatcactctctggcaaatgactaccaagcaggcgccgtattcgggggagcggcagcacatactgtacgcggtggtggcctacgacctgcgcccgtccctctccgctgccgtcttcgaggactcgctccccgggcagcgccttggggacgtcatccagcgctgctggagacccagcgcggcgcagaggccgagcgcgcggctgcttttggtggatctcacctctttgaaagctgaactcggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acyl phosphatidylethanolamine phospholipase D - protein tyrosine phosphatase, non-receptor type 9 - major facilitator superfamily domain containing 5 - UDP glycosyltransferase 3 family, polypeptide A1 |