UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene View larger

UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene

PTXBC068446

New product

Data sheet of UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC068446
Product type: DNA & cDNA
Ncbi symbol: UGT3A1
Origin species: Human
Product name: UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene
Size: 2ug
Accessions: BC068446
Gene id: 133688
Gene description: UDP glycosyltransferase 3 family, polypeptide A1
Synonyms: UDP-glucuronosyltransferase 3A1; UDP glycosyltransferase 3 family, polypeptide A1; UDPGT 3A1; UDP glycosyltransferase family 3 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgggcagcgggtgctgcttctagtggccttccttctttctggggtcctgctctcagaggctgccaaaatcctgacaatatctacactgggtggaagccattacctactgttggaccgggtgtctcagattcttcaagagcatggtcataatgtgactatgcttcatcagagtggaaagtttttgatcccagatattaaagaggaggaaaaatcataccaagttatcaggtggttttcacctgaagatcatcaaaaaagaattaagaagcattttgatagctacatagaaacagcattggatggcagaaaagaatctgaagcccttgtaaagctaatggaaatatttgggactcaatgtagttatttgctaagcagaaaggatataatggattccttaaagaatgagaactatgatctggtatttgttgaagcatttgatttctgttctttcctgattgctgagaagcttgtgaaaccatttgtggccattcttcccaccacattcggctctttggattttgggctaccaagccccttgtcttatgttccagtattcccttccttgctgactgatcacatggacttctggggccgagtgaagaattttctgatgttctttagtttctccaggagccaatgggacatgcagtctacatttgacaacaccatcaaggagcatttcccagaaggctctaggccagttttgtctcatcttctactgaaagcagagttgtggtttgttaactctgattttgcctttgattttgcccggcccctgcttcccaacactgtttatattggaggcttgatggaaaaacctattaaaccagtaccacaagacttggacaacttcattgccaactttggggatgcagggtttgtccttgtggcctttggctccatgttgaacacccatcagtcccaggaagtcctcaagaagatgcacaatgcctttgcccacctccctcaaggagtgatatggacatgtcagagttctcattggcccagagatgttcatttggccacaaatgtgaaaattgtggactggcttcctcagagtgacctcctggctcaccccagcatccgtctttttgtcactcatggtgggcagaacagcgtaatggaggccatccgtcatggtgtgcccatggtgggattaccagtcaatggagaccagcatggaaacatggtccgagtagtagccaaaaattatggtgtctctatccggttgaatcaggtcacagccgacacactgacacttacaatgaaacaagtcatagaagacaagaggtacaagtcggcagtggtggcagccagtgtcatcctgcactctcagcccctgagccccgcacagcggctggtgggctggatcgaccacatcctccagactgggggagcgacgcacctcaagccctatgccttccagcagccttggcatgagcagtacctcattgatgtctttgtgtttctgctggggctcactctgggcactatgtggctttgtgggaagctgctgggtgtggtggccaggtggctgcgtggggccaggaaggtgaagaagacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - differentially expressed in FDCP 8 homolog (mouse)
- ATPase, Na+/K+ transporting, alpha 4 polypeptide
- major facilitator superfamily domain containing 9
- calcium homeostasis endoplasmic reticulum protein

Buy UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene now

Add to cart