Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP1A4-ATPase, Na+/K+ transporting, alpha 4 polypeptide Gene
PTXBC028297
New product
Data sheet of ATP1A4-ATPase, Na+/K+ transporting, alpha 4 polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP1A4-ATPase, Na+/K+ transporting, alpha 4 polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028297 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP1A4 |
| Origin species: | Human |
| Product name: | ATP1A4-ATPase, Na+/K+ transporting, alpha 4 polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC028297 |
| Gene id: | 480 |
| Gene description: | ATPase, Na+/K+ transporting, alpha 4 polypeptide |
| Synonyms: | ATP1A1; ATP1AL2; sodium/potassium-transporting ATPase subunit alpha-4; ATPase, Na+/K+ transporting, alpha 4 polypeptide; ATPase, Na+/K+ transporting, alpha polypeptide-like 2; Na(+)/K(+) ATPase alpha-4 subunit; Na+/K+ ATPase 4; Na+/K+ ATPase, alpha-D polypeptide; Na,K-ATPase subunit alpha-C; sodium pump 4; sodium pump subunit alpha-4; sodium-potassium ATPase catalytic subunit alpha-4; sodium/potassium-transporting ATPase alpha-4 chain; ATPase Na+/K+ transporting subunit alpha 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccaggctctggctggattctttacctactttgtaatcctggctgagaatggttttaggcctgttgatctgctgggcatccgcctccactgggaagataaatacttgaatgacctggaggacagctacggacagcagtggacctatgagcaacgaaaagttgtggagttcacatgccaaacggccttttttgtcaccatcgtggttgtgcagtgggcggatctcatcatctccaagactcgccgcaactcacttttccagcagggcatgagaaacaaagtcttaatatttgggatcctggaggagacactcttggctgcatttctgtcctacactccaggcatggacgtggccctgcgaatgtacccactcaagataacctggtggctctgtgccattccctacagtattctcatcttcgtctatgatgaaatcagaaaactcctcatccgtcagcacccggatggctgggtggaaagggagacgtactactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major facilitator superfamily domain containing 9 - calcium homeostasis endoplasmic reticulum protein - suppression of tumorigenicity 14 (colon carcinoma) - family with sequence similarity 160, member B2 |