SHQ1-SHQ1 homolog (S. cerevisiae) Gene View larger

SHQ1-SHQ1 homolog (S. cerevisiae) Gene

PTXBC017204

New product

Data sheet of SHQ1-SHQ1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SHQ1-SHQ1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC017204
Product type: DNA & cDNA
Ncbi symbol: SHQ1
Origin species: Human
Product name: SHQ1-SHQ1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC017204
Gene id: 55164
Gene description: SHQ1 homolog (S. cerevisiae)
Synonyms: SHQ1, H/ACA ribonucleoprotein assembly factor; SHQ1 homolog; protein SHQ1 homolog; GRIM-1; Shq1p; gene associated with retinoid and interferon-induced mortality 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaccccggcgttcgacctcagccaggatccggacttcctgactatcgccatccgcgtgccctacgcccgggtctccgagttcgacgtctacttcgaggggtctgacttcaagttctacgccaagccatactttctcagattaacccttcctggaagaattgtagaaaatggaagtgagcaagggtcctatgatgcagataaaggaatttttaccattcgcctgcccaaagaaacccctggccagcattttgaggggctgaacatgttaactgctcttctggcaccaagaaaatccaggacagcaaaaccacttgtggaagaaataggtgcttctgagattcctgaggaagtagttgacgatgaagagtttgattgggaaattgagcagacaccctgtgaagaggtatcagaaagtgctttgaatccgcagtgccactatggatttggaaacttacgatcaggagtgttgcaacggttacaggatgaactgagtgatgttattgatattaaggatccagatttcacccctgcagctgaacgaagacagaagcgcctggccgctgagctggccaagtttgatcctgatcattatctagctgacttttttgaagatgaggcgattgaacagattttgaagtataatccttggtggactgacaaatattcaaaaatgatggcctttttggaaaagagtcaggaacaagaaaatcatgctacattagtgtctttttctgaagaagagaagtatcagctacgaaaatttgtcaataaatcttatctgctggacaagagagcctgtcgtcaagtgtgctacagtttgattgatatccttctggcatattgctatgaaacccgtgtcactgaaggagagaagaatgttgaatctgcatggaatatcaggaaactgagtccaacactatgctggtttgagacttggactaacgttcatgatatcatggtgtcttttggaagaagggtgttgtgttacccactctatcgccatttcaagctggtgatgaaggcctacagggacactataaagatattgcaactgggtaaaagtgcagttttaaagtgtctcctggatattcacaaaatttttcaggaaaatgacccagcgtacatactgaatgatctctacatctcagactactgtgtgtggattcagaaagtcaaatccaaaaagttggcagctcttgcagaagccttaaaggaagtctcccttacaaaggcccagctggggttagaactggaagaactagaagcagcagcactgcttgtccaggaggaagaaactgcattaaaagcagcccattcagtttctgggcagcagacactttgctccagctctgaggcaagtgattcggaggactcagacagcagcgtgtcatctggaaacgaagactcaggctcagattcagaacaagatgaactcaaagatagtccatctgagacagtcagttctttgcaaggtccctttcttgaagaaagcagtgcctttcttattgttgatggtggagtacgcagaaacacagccatccaggagtctgatgccagtcagggaaagccacttgcctcttcctggcctcttggagtgtctgggcctctgatagaggagcttggggaacaactgaagactacagttcaggtttctgaacccaagggcaccactgctgtaaaccgcagcaatattcaggagagagacggctgtcagacaccaaataattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - collagen, type VI, alpha 1
- histone cluster 1, H2al
- chemokine (C motif) ligand 2
- fibroblast growth factor 23

Buy SHQ1-SHQ1 homolog (S. cerevisiae) Gene now

Add to cart