Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2AL-histone cluster 1, H2al Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2AL-histone cluster 1, H2al Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069306 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2AL |
| Origin species: | Human |
| Product name: | HIST1H2AL-histone cluster 1, H2al Gene |
| Size: | 2ug |
| Accessions: | BC069306 |
| Gene id: | 8332 |
| Gene description: | histone cluster 1, H2al |
| Synonyms: | H2A/c; H2AFC; histone H2A type 1; H2A histone family, member C; H2A.1; histone 1, H2ai; histone cluster 1, H2ai; histone cluster 1 H2A family member i |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgggacgcggcaagcagggaggcaaagctcgcgccaaagccaagacccgctcttctcgtgccggtctccagttccccgtgggccgagtgcaccgactgctccgcaagggcaactatgctgagcgggtcggggccggcgcgccggtgtacctggcggcggtgctggagtacctgactgccgagatcctggagctggcgggcaacgccgcccgcgacaacaagaagacccgcattatcccgcgccacttgcagctggccatccgcaacgacgaggagctcaacaagctgctgggcaaagtaaccatcgctcagggtggtgtcctgcccaacatccaggctgtgctactgcccaagaagaccgagagtcaccacaaggccaaaggcaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C motif) ligand 2 - fibroblast growth factor 23 - thyrotropin-releasing hormone - myosin light chain kinase 2 |