Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of XCL2-chemokine (C motif) ligand 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XCL2-chemokine (C motif) ligand 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069360 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XCL2 |
| Origin species: | Human |
| Product name: | XCL2-chemokine (C motif) ligand 2 Gene |
| Size: | 2ug |
| Accessions: | BC069360 |
| Gene id: | 6846 |
| Gene description: | chemokine (C motif) ligand 2 |
| Synonyms: | SCM-1b; SCM1B; SCYC2; cytokine SCM-1 beta; XC chemokine ligand 2; c motif chemokine 2; chemokine (C motif) ligand 2; small inducible cytokine subfamily C, member 2; X-C motif chemokine ligand 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagacttctcatcctggccctccttggcatctgctctctcactgcatacattgtggaaggtgtagggagtgaagtctcacataggaggacctgtgtgagcctcactacccagcgactgccagttagcagaatcaagacctacaccatcacggaaggctccttgagagcagtaatttttattaccaaacgtggcctaaaagtctgtgctgatccacaagccacgtgggtgagagacgtggtcaggagcatggacaggaaatccaacaccagaaataacatgatccagaccaagccaacaggaacccagcaatcgaccaatacagctgtgaccctgactggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibroblast growth factor 23 - thyrotropin-releasing hormone - myosin light chain kinase 2 - popeye domain containing 2 |