Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCR1-chemokine (C-C motif) receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCR1-chemokine (C-C motif) receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC051306 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCR1 |
| Origin species: | Human |
| Product name: | CCR1-chemokine (C-C motif) receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC051306 |
| Gene id: | 1230 |
| Gene description: | chemokine (C-C motif) receptor 1 |
| Synonyms: | CD191; CKR-1; CKR1; CMKBR1; HM145; MIP1aR; SCYAR1; C-C chemokine receptor type 1; C-C CKR-1; CC-CKR-1; CCR-1; LD78 receptor; MIP-1alpha-R; RANTES receptor; RANTES-R; chemokine (C-C motif) receptor 1; macrophage inflammatory protein 1-alpha receptor; C-C motif chemokine receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaactccaaacaccacagaggactatgacacgaccacagagtttgactatggggatgcaactccgtgccagaaggtgaacgagagggcctttggggcccaactgctgccccctctgtactccttggtatttgtcattggcctggttggaaacatcctggtggtcctggtccttgtgcaatacaagaggctaaaaaacatgaccagcatctacctcctgaacctggccatttctgacctgctcttcctgttcacgcttcccttctggatcgactacaagttgaaggatgactgggtttttggtgatgccatgtgtaagatcctctctgggttttattacacaggcttgtacagcgagatctttttcatcatcctgctgacgattgacaggtacctggccatcgtccacgccgtgtttgccttgcgggcacggaccgtcacttttggtgtcatcaccagcatcatcatttgggccctggccatcttggcttccatgccaggcttatacttttccaagacccaatgggaattcactcaccacacctgcagccttcactttcctcacgaaagcctacgagagtggaagctgtttcaggctctgaaactgaacctctttgggctggtattgcctttgttggtcatgatcatctgctacacagggattataaagattctgctaagacgaccaaatgagaagaaatccaaagctgtccgtttgatttttgtcatcatgatcatcttttttctcttttggaccccctacaatttgactatacttatttctgttttccaagacttcctgttcacccatgagtgtgagcagagcagacatttggacctggctgtgcaagtgacggaggtgatcgcctacacgcactgctgtgtcaacccagtgatctacgccttcgttggtgagaggttccggaagtacctgcggcagttgttccacaggcgtgtggctgtgcacctggttaaatggctccccttcctctccgtggacaggctggagagggtcagctccacatctccctccacaggggagcatgaactctctgctgggttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor 176 - beta-site APP-cleaving enzyme 1 - tripartite motif-containing 56 - chemokine (C-C motif) ligand 24 |