Login to display prices
Login to display prices
BACE1-beta-site APP-cleaving enzyme 1 Gene View larger

BACE1-beta-site APP-cleaving enzyme 1 Gene

PTXBC065492

New product

Data sheet of BACE1-beta-site APP-cleaving enzyme 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BACE1-beta-site APP-cleaving enzyme 1 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC065492
Ncbi symbol: BACE1
Product name: BACE1-beta-site APP-cleaving enzyme 1 Gene
Size: 2ug
Accessions: BC065492
Gene id: 23621
Gene description: beta-site APP-cleaving enzyme 1
Synonyms: ASP2; HSPC104; beta-secretase 1; APP beta-secretase; asp 2; aspartyl protease 2; beta-secretase 1 precursor variant 1; beta-site APP cleaving enzyme 1; beta-site APP-cleaving enzyme; beta-site amyloid beta A4 precursor protein-cleaving enzyme; memapsin-2; membrane-associated aspartic protease 2; transmembrane aspartic proteinase Asp2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccaagccctgccctggctcctgctgtggatgggcgcgggagtgctgcctgcccacggcacccagcacggcatccggctgcccctgcgcagcggcctggggggcgcccccctggggctgcggctgccccgggagaccgacgaagagcccgaggagcccggccggaggggcagctttgtggagatggtggacaacctgaggggcaagtcggggcagggctactacgtggagatgaccgtgggcagccccccgcagacgctcaacatcctggtggatacaggcagcagtaactttgcagtgggtgctgccccccaccccttcctgcatcgctactaccagaggcagctgtccagcacataccgggacctccggaagggtgtgtatgtgccctacacccagggcaagtgggaaggggagctgggcaccgacctggtaagcatcccccatggccccaacgtcactgtgcgtgccaacattgctgccatcactgaatcagacaagttcttcatcaacggctccaactgggaaggcatcctggggctggcctatgctgagattgccaggcctgacgactccctggagcctttctttgactctctggtaaagcagacccacgttcccaacctcttctccctgcagctttgtggtgctggcttccccctcaaccagtctgaagtgctggcctctgtcggagggagcatgatcattggaggtatcgaccactcgctgtacacaggcagtctctggtatacacccatccggcgggagtggtattatgaggtgatcattgtgcgggtggagatcaatggacaggatctgaaaatggactgcaaggagtacaactatgacaagagcattgtggacagtggcaccaccaaccttcgtttgcccaagaaagtgtttgaagctgcagtcaaatccatcaaggcagcctcctccacggagaagttccctgatggtttctggctaggagagcagctggtgtgctggcaagcaggcaccaccccttggaacattttcccagtcatctcactctacctaatgggtgaggttaccaaccagtccttccgcatcaccatccttccgcagcaatacctgcggccagtggaagatgtggccacgtcccaagacgactgttacaagtttgccatctcacagtcatccacgggcactgttatgggagctgttatcatggagggcttctacgttgtctttgatcgggcccgaaaacgaattggctttgctgtcagcgcttgccatgtgcacgatgagttcaggacggcagcggtggaaggcccttttgtcaccttggacatggaagactgtggctacaacattccacagacagatgagtcaaccctcatgaccatagcctatgtcatggctgccatctgcgccctcttcatgctgccactctgcctcatggtgtgtcagtggcgctgcctccgctgcctgcgccagcagcatgatgactttgctgatgacatctccctgctgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: