PTXBC069391
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069391 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL24 |
| Origin species: | Human |
| Product name: | CCL24-chemokine (C-C motif) ligand 24 Gene |
| Size: | 2ug |
| Accessions: | BC069391 |
| Gene id: | 6369 |
| Gene description: | chemokine (C-C motif) ligand 24 |
| Synonyms: | Ckb-6; MPIF-2; MPIF2; SCYA24; C-C motif chemokine 24; CK-beta-6; chemokine (C-C motif) ligand 24; eosinophil chemotactic protein 2; eotaxin-2; myeloid progenitor inhibitory factor 2; small inducible cytokine subfamily A (Cys-Cys), member 24; small-inducible cytokine A24; C-C motif chemokine ligand 24 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggcctgatgaccatagtaaccagccttctgttccttggtgtctgtgcccaccacatcatccctacgggctctgtggtcatcccctctccctgctgcatgttctttgtttccaagagaattcctgagaaccgagtggtcagctaccagctgtccagcaggagcacatgcctcaaggcaggagtgatcttcaccaccaagaagggccagcagttctgtggcgaccccaagcaggagtgggtccagaggtacatgaagaacctggacgccaagcagaagaaggcttcccctagggccagggcagtggctgtcaagggccctgtccagagatatcctggcaaccaaaccacctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) ligand 28 - TSC22 domain family, member 2 - kallikrein-related peptidase 15 - kallikrein-related peptidase 15 |