CCL24-chemokine (C-C motif) ligand 24 Gene View larger

CCL24-chemokine (C-C motif) ligand 24 Gene

PTXBC069391

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCL24-chemokine (C-C motif) ligand 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCL24-chemokine (C-C motif) ligand 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069391
Product type: DNA & cDNA
Ncbi symbol: CCL24
Origin species: Human
Product name: CCL24-chemokine (C-C motif) ligand 24 Gene
Size: 2ug
Accessions: BC069391
Gene id: 6369
Gene description: chemokine (C-C motif) ligand 24
Synonyms: Ckb-6; MPIF-2; MPIF2; SCYA24; C-C motif chemokine 24; CK-beta-6; chemokine (C-C motif) ligand 24; eosinophil chemotactic protein 2; eotaxin-2; myeloid progenitor inhibitory factor 2; small inducible cytokine subfamily A (Cys-Cys), member 24; small-inducible cytokine A24; C-C motif chemokine ligand 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggcctgatgaccatagtaaccagccttctgttccttggtgtctgtgcccaccacatcatccctacgggctctgtggtcatcccctctccctgctgcatgttctttgtttccaagagaattcctgagaaccgagtggtcagctaccagctgtccagcaggagcacatgcctcaaggcaggagtgatcttcaccaccaagaagggccagcagttctgtggcgaccccaagcaggagtgggtccagaggtacatgaagaacctggacgccaagcagaagaaggcttcccctagggccagggcagtggctgtcaagggccctgtccagagatatcctggcaaccaaaccacctgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-C motif) ligand 28
- TSC22 domain family, member 2
- kallikrein-related peptidase 15
- kallikrein-related peptidase 15

Buy CCL24-chemokine (C-C motif) ligand 24 Gene now

Add to cart