Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene
PTXBC004218
New product
Data sheet of SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004218 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SIRT6 |
| Origin species: | Human |
| Product name: | SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC004218 |
| Gene id: | 51548 |
| Gene description: | sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) |
| Synonyms: | SIR2L6; NAD-dependent protein deacetylase sirtuin-6; SIR2-like protein 6; regulatory protein SIR2 homolog 6; sir2-related protein type 6; sirtuin type 6; sirtuin 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagcgaggtctggcccccaagttcgacaccacctttgagagcgcgcggcccacgcagacccacatggcgctggtgcagctggagcgcgtgggcctcctccgcttcctggtcagccagaacgtggacgggctccatgtgcgctcaggcttccccagggacaaactggcagagctccacgggaacatgtttgtggaagaatgtgccaagtgtaagacgcagtacgtccgagacacagtcgtgggcaccatgggcctgaaggccacgggccggctctgcaccgtggctaaggcaagggggctgcgagcctgcaggaacgccgacctgtccatcacgctgggtacatcgctgcagatccggcccagcgggaacctgccgctggctaccaagcgccggggaggccgcctggtcatcgtcaacctgcagcccaccaagcacgaccgctatgctgacctccgcatccatggctacgttgacgaggtcatgacccggctcatgaagcacctggggctggagatccccgcctgggacggcccccgtgtgctggagagggcgctgccacccctgccccgcccgcccacccccaagctggagcccaaggaggaatctcccacccggatcaacggctctatccccgccggccccaagcaggagccctgcgcccagcacaacggctcagagcccgccagccccaaacgggagcggcccaccagccctgccccccacagaccccccaaaagggtgaaggccaaggcggtccccagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 - pleckstrin homology domain containing, family G (with RhoGef domain) member 4 - pleckstrin homology domain containing, family G (with RhoGef domain) member 6 |