Cart 27 Product Products 4 224,45 € (empty)
-
1 x SMPX-small...113,40 € -
1 x LSM5-LSM5...113,40 € -
1 x LOC133874-...113,40 € -
1 x PUS7-pseud...113,40 € -
1 x SLC22A23-s...113,40 € -
1 x SIRT6-sirt...113,40 € -
-
1 x NHP2-NHP2...113,40 € -
1 x SLC18A1-so...121,50 € -
1 x ZNF167-zin...121,50 € -
1 x KCNMA1-pot...113,40 € -
-
-
1 x LSM3-LSM3...113,40 € -
1 x LAT-linker...113,40 € -
1 x RYBP-RING1...113,40 € -
1 x PTPLB-prot...113,40 € -
1 x CCL14-chem...113,40 € -
-
-
-
-
1 x C10orf91-c...113,40 € -
1 x ERO1LB-ERO...121,50 € -
1 x CFC1-cript...113,40 € -
-
No products
To be determined Shipping
4 224,45 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 27 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 224,45 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 224,45 €
View larger 
SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene
PTXBC052250
New product
Data sheet of SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC052250 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC7A8 |
| Origin species: | Human |
| Product name: | SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene |
| Size: | 2ug |
| Accessions: | BC052250 |
| Gene id: | 23428 |
| Gene description: | solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 |
| Synonyms: | LAT2; LPI-PC1; large neutral amino acids transporter small subunit 2; L-type amino acid transporter 2; integral membrane protein E16H; solute carrier family 7 (amino acid transporter light chain, L system), member 8; solute carrier family 7 (amino acid transporter, L-type), member 8; solute carrier family 7 (cationic amino acid transporter, y+ system), member 8; solute carrier family 7 member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagaaggagccaggcaccgaaacaacaccgaaaagaaacacccaggtgggggcgagtcggacgccagccccgaggctggttccggagggggcggagtagccctgaagaaagagatcggattggtcagtgcctgtggtatcatcgtagggaacatcatcggctctggaatctttgtctcgccaaagggagtgctggagaatgctggttctgtgggccttgctctcatcgtctggattgtgacgggcttcatcacagttgtgggagccctctgctatgctgaactcggggtcaccatccccaaatctggaggtgactactcctatgtcaaggacatcttcggaggactggctgggttcctgaggctgtggattgctgtgctggtgatctaccccaccaaccaggctgtcatcgccctcaccttctccaactacgtgctgcagccgctcttccccacctgcttccccccagagtctggccttcggctcctggctgccatctgcttattgctcctcacatgggtcaactgttccagtgtgcggtgggccacccgggttcaagacatcttcacagctgggaagctcctggccttggccctgattatcatcatggggattgtacagatatgcaaaggagagtacttctggctggagccaaagaatgcatttgagaatttccaggaacctgacatcggcctcgtcgcactggctttccttcagggctcctttgcctatggaggctggaactttctgaattacgtgactgaggagcttgttgatccctacaagaaccttcccagagccatcttcatctccatcccactggtcacatttgtgtatgtctttgccaatgtcgcttatgtcactgcaatgtccccccaggagctgctggcatccaacgccgtcgctgtgacttttggagagaagctcctaggagtcatggcctggatcatgcccatttctgttgccctgtccacatttggaggagttaatgggtctctcttcacctcctctcggctgttcttcgctggagcccgagagggccaccttcccagtgtgttggccatgatccacgtgaagcgctgcaccccaatcccagccctgctcttcacatgcatctccaccctgctgatgctggtcaccagtgacatgtacacactcatcaactacgtgggcttcatcaactacctcttctatggggtcacggttgctggacagatagtccttcgctggaagaagcctgatatcccccgccccatcaagatcaacctgctgttccccatcatctacttgctgttctgggccttcctgctggtcttcagcctgtggtcagagccggtggtgtgtggcattggcctggccatcatgctgacaggagtgcctgtctatttcctgggtgtttactggcaacacaagcccaagtgtttcagtgacttcattgagctgctaaccctggtgagccagaagatgtgtgtggtcgtgtaccccgaggtggagcggggctcagggacagaggaggctaatgaggacatggaggagcagcagcagcccatgtaccaacccactcccacgaaggacaaggacgtggcggggcagccccagccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 - pleckstrin homology domain containing, family G (with RhoGef domain) member 4 - pleckstrin homology domain containing, family G (with RhoGef domain) member 6 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |