Login to display prices
Login to display prices
SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene View larger

SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene

PTXBC052250

New product

Data sheet of SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC052250
Ncbi symbol: SLC7A8
Product name: SLC7A8-solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene
Size: 2ug
Accessions: BC052250
Gene id: 23428
Gene description: solute carrier family 7 (cationic amino acid transporter, y+ system), member 8
Synonyms: LAT2; LPI-PC1; large neutral amino acids transporter small subunit 2; L-type amino acid transporter 2; integral membrane protein E16H; solute carrier family 7 (amino acid transporter light chain, L system), member 8; solute carrier family 7 (amino acid transporter, L-type), member 8; solute carrier family 7 (cationic amino acid transporter, y+ system), member 8; solute carrier family 7 member 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaaggagccaggcaccgaaacaacaccgaaaagaaacacccaggtgggggcgagtcggacgccagccccgaggctggttccggagggggcggagtagccctgaagaaagagatcggattggtcagtgcctgtggtatcatcgtagggaacatcatcggctctggaatctttgtctcgccaaagggagtgctggagaatgctggttctgtgggccttgctctcatcgtctggattgtgacgggcttcatcacagttgtgggagccctctgctatgctgaactcggggtcaccatccccaaatctggaggtgactactcctatgtcaaggacatcttcggaggactggctgggttcctgaggctgtggattgctgtgctggtgatctaccccaccaaccaggctgtcatcgccctcaccttctccaactacgtgctgcagccgctcttccccacctgcttccccccagagtctggccttcggctcctggctgccatctgcttattgctcctcacatgggtcaactgttccagtgtgcggtgggccacccgggttcaagacatcttcacagctgggaagctcctggccttggccctgattatcatcatggggattgtacagatatgcaaaggagagtacttctggctggagccaaagaatgcatttgagaatttccaggaacctgacatcggcctcgtcgcactggctttccttcagggctcctttgcctatggaggctggaactttctgaattacgtgactgaggagcttgttgatccctacaagaaccttcccagagccatcttcatctccatcccactggtcacatttgtgtatgtctttgccaatgtcgcttatgtcactgcaatgtccccccaggagctgctggcatccaacgccgtcgctgtgacttttggagagaagctcctaggagtcatggcctggatcatgcccatttctgttgccctgtccacatttggaggagttaatgggtctctcttcacctcctctcggctgttcttcgctggagcccgagagggccaccttcccagtgtgttggccatgatccacgtgaagcgctgcaccccaatcccagccctgctcttcacatgcatctccaccctgctgatgctggtcaccagtgacatgtacacactcatcaactacgtgggcttcatcaactacctcttctatggggtcacggttgctggacagatagtccttcgctggaagaagcctgatatcccccgccccatcaagatcaacctgctgttccccatcatctacttgctgttctgggccttcctgctggtcttcagcctgtggtcagagccggtggtgtgtggcattggcctggccatcatgctgacaggagtgcctgtctatttcctgggtgtttactggcaacacaagcccaagtgtttcagtgacttcattgagctgctaaccctggtgagccagaagatgtgtgtggtcgtgtaccccgaggtggagcggggctcagggacagaggaggctaatgaggacatggaggagcagcagcagcccatgtaccaacccactcccacgaaggacaaggacgtggcggggcagccccagccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: