Cart 11 Product Products 1 606,33 € (empty)
-
-
1 x ZNF193-zin...121,50 € -
1 x C6orf134-c...121,50 € -
1 x MRGPRX3-MA...121,50 € -
-
1 x BPI-bacter...121,50 € -
1 x ZNF200-zin...121,50 € -
1 x SLAMF1-sig...113,40 € -
-
-
1 x COQ7-coenz...113,40 €
No products
To be determined Shipping
1 606,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 606,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 606,33 €
View larger 
SLC7A7-solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene
PTXBC003062
New product
Data sheet of SLC7A7-solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC7A7-solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC003062 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC7A7 |
| Origin species: | Human |
| Product name: | SLC7A7-solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene |
| Size: | 2ug |
| Accessions: | BC003062 |
| Gene id: | 9056 |
| Gene description: | solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 |
| Synonyms: | LAT3; LPI; MOP-2; Y+LAT1; y+LAT-1; Y+L amino acid transporter 1; monocyte amino acid permease 2; solute carrier family 7 (amino acid transporter light chain, y+L system), member 7; solute carrier family 7 (cationic amino acid transporter, y+ system), member 7; y(+)L-type amino acid transporter 1; solute carrier family 7 member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttgacagcactgagtatgaagtggcctcccagcctgaggtggaaacctcccctttgggtgatggggccagcccagggccggagcaggtgaagctgaagaaggagatctcactgcttaacggcgtgtgcctgattgtggggaacatgatcggctcgggcatctttgtttcccccaagggtgtgctcatatacagtgcctcctttggtctctctctggtcatctgggctgtcgggggcctcttctccgtctttggggccctttgttatgcggaactgggcaccaccattaagaaatctggggccagctatgcctatatcctggaggcctttggaggattccttgctttcatcagactctggacctccctgctcatcattgagcccaccagccaggccatcattgccatcacctttgccaactacatggtacagcctctcttcccgagctgcttcgccccttatgctgccagccgcctgctggctgctgcctgcatttgtctcttaaccttcattaactgtgcctatgtcaaatggggaaccctggtacaagatattttcacctatgctaaagtattggcactgatcgcggtcatcgttgcaggcattgttagacttggccagggagcctctactcattttgagaattcctttgagggttcatcatttgcagtgggtgacattgccctggcactgtactcagctctgttctcctactcaggctgggacaccctcaactatgtcactgaagagatcaagaatcctgagaggaacctgcccctctccattggcatctccatgcccattgtcaccatcatctatatcttgaccaatgtggcctattatactgtgctagacatgagagacatcttggccagtgatgctgttgctgtgacttttgcagatcagatatttggaatatttaactggataattccactgtcagttgcattatcctgttttggtggcctcaatgcctccattgtggctgcttctaggcttttctttgtgggctcaagagaaggccatctccctgatgccatctgcatgatccatgttgagcggttcacaccagtgccttctctgctcttcaatggtatcatggcattgatctacttgtgcgtggaagacatcttccagctcattaactactacagcttcagctactggttctttgtggggctttctattgtgggtcagctttatctgcgctggaaggagcctgatcgacctcgtcccctcaagctcagcgttttcttcccgattgtcttctgcctctgcaccatcttcctggtggctgttccactttacagtgatactatcaactccctcatcggcattgccattgccctctcaggcctgcccttttacttcctcatcatcagagtgccagaacataagcgaccgctttacctccgaaggatcgtggggtctgccacaaggtacctccaggtcctgtgtatgtcagttgctgcagaaatggatttggaagatggaggagagatgcccaagcaacgggatcccaagtctaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family G (with RhoGef domain) member 4 - pleckstrin homology domain containing, family G (with RhoGef domain) member 6 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 - leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 |