Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LILRA4-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 Gene
PTXBC109198
New product
Data sheet of LILRA4-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LILRA4-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109198 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LILRA4 |
| Origin species: | Human |
| Product name: | LILRA4-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC109198 |
| Gene id: | 23547 |
| Gene description: | leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 |
| Synonyms: | CD85g; leukocyte immunoglobulin-like receptor subfamily A member 4; CD85 antigen-like family member G; immunoglobulin-like transcript 7; leucocyte Ig-like receptor A4; leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4; leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 4; leukocyte immunoglobulin like receptor A4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgaggcacatattaaaaacactggagtctgaaaacaaggtcaaactctccatcccatccatgatgtgggaacatgcagggcgatatcactgttactatcagagccctgcaggctggtcagagcccagcgaccccctggagctggtggtgacagcctacagcagacccaccctgtccgccctgccaagccctgtggtaacctcaggagtgaacgtgaccctccggtgtgcctcacggctgggactgggcaggttcactctgattgaggaaggagaccacaggctctcctggaccctgaactcacaccaacacaaccatggaaagttccaggccctgttccccatgggccccctgaccttcagcaacaggggtacattcagatgctacggctatgaaaacaacaccccatacgtgtggtcggaacccagtgaccccctgcagctactggtgtcaggcgtgtctaggaagccctccctcctgaccctgcagggccctgtcgtgacccccggagagaatctgaccctccagtgtggctctgatgtcggctacatcagatacactctgtacaaggagggggccgatggcctcccccagcgccctggccggcagccccaggctgggctctcccaggccaacttcaccctgagccctgtgagccgctcctacgggggccagtacagatgctacggcgcacacaacgtctcctccgagtggtcggcccccagtgaccccctggacatcctgatcgcaggacagatctctgacagaccctccctctcagtgcagccgggccccacggtgacctcaggagagaaggtgaccctgctgtgtcagtcatgggacccgatgttcactttccttctgaccaaggagggggcagcccatcccccgttgcgtctgagatcaatgtacggagctcataagtaccaggctgaattccccatgagtcctgtgacctcagcccacgcggggacctacaggtgctacggctcacgcagctccaacccctacctgctgtctcaccccagtgagcccctggagctcgtggtctcaggagcaactgagaccctcaatccagcacaaaagaagtcagattccaagactgccccacacctccaggattacacagtggagaatctcatccgcatgggtgtggctggcttggtcctgctgttcctcgggattctgttatttgaggctcagcacagccagagaagccccccaaggtgcagccaggaggcaaacagcagaaaggacaatgcacccttcagagtggtggagccttgggaacagatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) - solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 - pleckstrin homology domain containing, family G (with RhoGef domain) member 3 - TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa |