Cart 40 Product Products 6 921,40 € (empty)
-
1 x SMPX-small...113,40 € -
1 x LSM5-LSM5...113,40 € -
1 x LOC133874-...113,40 € -
1 x PUS7-pseud...113,40 € -
1 x SLC22A23-s...113,40 € -
1 x SIRT6-sirt...113,40 € -
-
1 x NHP2-NHP2...113,40 € -
1 x SLC18A1-so...121,50 € -
1 x ZNF167-zin...121,50 € -
1 x KCNMA1-pot...113,40 € -
-
-
1 x LSM3-LSM3...113,40 € -
1 x LAT-linker...113,40 € -
1 x RYBP-RING1...113,40 € -
1 x PTPLB-prot...113,40 € -
1 x CCL14-chem...113,40 € -
-
-
-
-
1 x C10orf91-c...113,40 € -
1 x ERO1LB-ERO...121,50 € -
1 x CFC1-cript...113,40 € -
-
-
-
1 x C1orf149-c...113,40 € -
1 x C19orf40-c...113,40 € -
1 x USP32-ubiq...121,50 € -
1 x ANKRD13A-a...113,40 € -
1 x UBE2S-ubiq...113,40 € -
1 x MPZL3-myel...113,40 € -
-
-
-
-
-
No products
To be determined Shipping
6 921,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 40 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 921,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 921,40 €
View larger 
SLC7A4-solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 Gene
PTXBC107160
New product
Data sheet of SLC7A4-solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC7A4-solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC107160 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC7A4 |
| Origin species: | Human |
| Product name: | SLC7A4-solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC107160 |
| Gene id: | 6545 |
| Gene description: | solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 |
| Synonyms: | CAT-4; CAT4; HCAT3; cationic amino acid transporter 4; Ig heavy chain variable region; VH 3 family; solute carrier family 7 (cationic amino acid transporter, y+ system), member 4; solute carrier family 7 (orphan transporter), member 4; solute carrier family 7 member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgggggctgcccaccattgctagcctggcacgcttatgccagaagctgaaccgcctgaagccgctggaggactccaccatggagacgtcactgcggcgctgcctgtccacgctggacctgactcttctgggcgtgggtggcatggtgggctcgggtctctacgtgctcacaggtgccgtggccaaggaggtggctggccctgctgtgctcttgtccttcggtgtggccgctgtggcctccctgctggcagccctatgctatgcagaatttggggcacgtgtgccacgcacgggctctgcctacctgttcacctacgtatccatgggcgagctgtgggccttcctcatcggctggaatgttctcctcgaatacatcatcggtggcgccgccgtggcccgtgcctggagtggctacctggactctatgttcagccacagcatccgcaacttcactgagacccacgtgggttcttggcaggtgcccctcctgggccactacccggacttcctggctgctggcatcatcctcctggcctctgcctttgtctcctgtggagcccgcgtgtcctcctggctcaatcacaccttctcggccatcagcctgcttgtcattctcttcattgtcatcctgggcttcatcctggcccagcctcacaactggagcgctgacgaaggcggctttgcacccttcggcttctccggcgtcatggccggcactgcctcctgcttctatgctttcgtgggcttcgacgtcattgccgcctccagtgaggaggcccagaacccacggcggtctgtgcctctggccatcgccatctcgcttgccattgcagctggtgcctacatccttgtctccaccgtgctaaccctcatggtgccctggcacagcctggaccccgactcagcgcttgcagatgccttctaccagcggggctacaggtgggctggcttcatcgtggcagctggctccatctgcgccatgaacaccgtcctgctcagcctcctcttctccctgccacgcattgtctatgccatggccgccgatgggctcttcttccaggtgtttgcccatgtgcacccccggacacaggtgcctgtggcgggcaccctggcgttcgggctcctcacggccttcctggcactgctgctggacctggagtcgctggttcagttcctgtcccttggcacactcctggcctacacattcgtggccaccagtatcattgtgctgcgcttccagaagtcttccccgcccagctccccaggcccagccagccctggccccctgaccaagcagcagagctccttctcagaccacctacagctggtgggcactgtacacgcctccgtccctgagccaggggagctgaagccagccctgaggccctacctgggcttcttggatgggtacagccctggagcagtggtgacttgggcgcttggcgttatgttggcctcagccatcaccataggctgcgtgcttgtctttgggaactcgaccctgcacctcccacactggggttacatcctgctgctcctgctcaccagtgtcatgtttctgctcagcctccttgtcctgggggctcaccagcaacagtatcgggaagacttatttcagatccccatggttcccctgattccagccctgagcatcgtcctcaacatctgcctcatgctgaaacttagctatctgacctgggtgcgcttctccatctggctgctgatgggacttgcagtgtatttcggctatggcatccggcatagcaaggagaaccagcgggagctgccagggctgaactccacacactacgtggtattccccaggggcagcctggaggagacagtgcaggctatgcagccccccagccaggcaccagcacaggaccctggccatatggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology domain containing, family G (with RhoGef domain) member 3 - TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa - solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 - solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 |