Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IGF2-insulin-like growth factor 2 (somatomedin A) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGF2-insulin-like growth factor 2 (somatomedin A) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042127 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGF2 |
| Origin species: | Human |
| Product name: | IGF2-insulin-like growth factor 2 (somatomedin A) Gene |
| Size: | 2ug |
| Accessions: | BC042127 |
| Gene id: | 3481 |
| Gene description: | insulin-like growth factor 2 (somatomedin A) |
| Synonyms: | C11orf43; GRDF; IGF-II; PP9974; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin; insulin like growth factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccccgggggtcgtccatgccagtccgcctcagtcgcagagggtccctcggcaagcgccctgtgagtgggccattcggaacattggacagaagcccaaagagccaaattgtcacaattgtggaacccacattggcctgagatccaaaacgcttcgaggcaccccaaattacctgcccattcgtcaggacacccacccacccagtgttatattctgcctcgccggagtgggtgttcccgggggcacttgccgaccagccccttgcgtccccaggtttgcagctctcccctgggccactaaccatcctggcccgggctgcctgtctgacctccgtgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock transcription factor, Y-linked 1 - hyaluronan and proteoglycan link protein 3 - 5-hydroxytryptamine (serotonin) receptor 2B - calcium and integrin binding family member 3 |