HTR2B-5-hydroxytryptamine (serotonin) receptor 2B Gene View larger

HTR2B-5-hydroxytryptamine (serotonin) receptor 2B Gene

PTXBC063123

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HTR2B-5-hydroxytryptamine (serotonin) receptor 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HTR2B-5-hydroxytryptamine (serotonin) receptor 2B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063123
Product type: DNA & cDNA
Ncbi symbol: HTR2B
Origin species: Human
Product name: HTR2B-5-hydroxytryptamine (serotonin) receptor 2B Gene
Size: 2ug
Accessions: BC063123
Gene id: 3357
Gene description: 5-hydroxytryptamine (serotonin) receptor 2B
Synonyms: 5-HT(2B); 5-HT-2B; 5-HT2B; 5-hydroxytryptamine receptor 2B; 5-HT 2B receptor; 5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled; 5-hydroxytryptamine 2B receptor; 5-hydroxytryptamine receptor 2B variant b; serotonin receptor 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctctcttacagagtgtctgaacttcaaagcacaattcctgagcacattttgcagagcacctttgttcacgttatctcttctaactggtctggattacagacagaatcaataccagaggaaatgaaacagattgttgaggaacagggaaataaactgcactgggcagctcttctgatactcatggtgataatacccacaattggtggaaatacccttgttattctggctgtttcactggagaagaagctgcagtatgctactaattactttctaatgtccttggcggtggctgatttgctggttggattgtttgtgatgccaattgccctcttgacaataatgtttgaggctatgtggcccctcccacttgttctatgtcctgcctggttatttcttgacgttctcttttcaaccgcatccatcatgcatctctgtgccatttcagtggatcgttacatagccatcaaaaagccaatccaggccaatcaatataactcacgggctacagcattcatcaagattacagtggtgtggttaatttcaataggcattgccattccagtccctattaaagggatagagactgatgtggacaacccaaacaatatcacttgtgtgctgacaaaggaacgttttggcgatttcatgctctttggctcactggctgccttcttcacacctcttgcaattatgattgtcacctactttctcactatccatgctttacagaagaaggcttacttagtcaaaaacaagccacctcaacgcctaacatggttgactgtgtctacagttttccaaagggatgaaacaccttgctcgtcaccggaaaaggtggcaatgctggatggttctcgaaaggacaaggctctgcccaactcaggtgatgaaacacttatgcgaagaacatccacaattgggaaaaagtcagtgcagaccatttccaacgaacagagagcctcaaaggtcctagggattgtgtttttcctctttttgcttatgtggtgtcccttctttattacaaatataactttagttttatgtgattcctgtaaccaaactactctccaaatgctcctggagatatttgtgtggataggctatgtttcctcaggagtgaatcctttggtctacaccctcttcaataagacatttcgggatgcatttggccgatatatcacctgcaattaccgggccacaaagtcagtaaaaactctcagaaaacgctccagtaagatctacttccggaatccaatggcagagaactctaagtttttcaagaaacatggaattcgaaatgggattaaccctgccatgtaccagagtccaatgaggctccgaagttcaaccattcagtcttcatcaatcattctactagatacgcttctcctcactgaaaatgaaggtgacaaaactgaagagcgagttagttatgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcium and integrin binding family member 3
- 5-hydroxytryptamine (serotonin) receptor 1E
- 5-hydroxytryptamine (serotonin) receptor 2A
- interferon induced with helicase C domain 1

Buy HTR2B-5-hydroxytryptamine (serotonin) receptor 2B Gene now

Add to cart