Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IFIH1-interferon induced with helicase C domain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFIH1-interferon induced with helicase C domain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046208 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFIH1 |
| Origin species: | Human |
| Product name: | IFIH1-interferon induced with helicase C domain 1 Gene |
| Size: | 2ug |
| Accessions: | BC046208 |
| Gene id: | 64135 |
| Gene description: | interferon induced with helicase C domain 1 |
| Synonyms: | AGS7; Hlcd; IDDM19; MDA-5; MDA5; RLR-2; SGMRT1; interferon-induced helicase C domain-containing protein 1; CADM-140 autoantigen; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide; RIG-I-like receptor 2; RNA helicase-DEAD box protein 116; clinically amyopathic dermatomyositis autoantigen 140 kDa; helicard; helicase with 2 CARD domains; melanoma differentiation-associated gene 5; melanoma differentiation-associated protein 5; murabutide down-regulated protein; interferon induced with helicase C domain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgaatgggtattccacagacgagaatttccgctatctcatctcgtgcttcagggccagggtgaaaatgtacatccaggtggagcctgtgctggactacctgacctttctgcctgcagaggtgaaggagcagattcagaggacagtcgccacctccgggaacatgcaggcagttgaactgctgctgagcaccttggagaagggagtctggcaccttggttggactcgggaattcgtggaggccctccggagaaccggcagccctctggccgcccgctacatgaaccctgagctcacggacttgccctctccatcgtttgagaacgctcatgatgaatatctccaactgctgaacctccttcagcccactctggtggacaagcttctagttagagacgtcttggataagtgcatggaggaggaactgttgacaattgaagacagaaaccggattgctgctgcagaaaacaatggaaatgaatcaggtgtaagagagctactaaaaaggattgtgcagaaagaaaactggttctctgcatttctgaatgttcttcgtcaaacaggaaacaatgaacttgtccaagagttaacaggctctgattgctcagaaagcaatgcaggtatttgtaattttactgaggaagattcttcaaattctgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spermatogenesis and centriole associated 1 - spastic paraplegia 11 (autosomal recessive) - replication factor C (activator 1) 1, 145kDa - similar to hypothetical protein FLJ36492 |