No products
Prices are tax excluded
PTXBC068597
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC068597 |
Product type: | DNA & cDNA |
Ncbi symbol: | MGC87631 |
Origin species: | Human |
Product name: | MGC87631-similar to hypothetical protein FLJ36492 Gene |
Size: | 2ug |
Accessions: | BC068597 |
Gene id: | 339184 |
Gene description: | similar to hypothetical protein FLJ36492 |
Synonyms: | coiled-coil domain containing 144 family, N-terminal like |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcctcctggggtggagaaaagcggggaggggctggggggtctccgaagccggcagtctacgccacgaggaagacccctagtgttgggagccaggaggaccagtggtacttggactacccgggggaccagtggtccttgggcttctcctacagctggtggaagaacagcgtcggcagcgagagcaagcacggtgagggcgccttagaccagctccagcacgatgtccgcctggaagatcttggcgagctccacagagctgcccggtcgggcgacgtccctggggtggagcacgtcttggctcctggagacactggcgtggacaagagggataggaagaagagcattcagcaactagttcctgaatataaggaaaaacagacacctgaaagtcttcctcaaaataacaatccagctgctccaagccaggctgaaggaggagaaggaggagtcgcctgtggtacggtggagcagatgacgtggctctgcagcttgcctcatgcagttggtggtggagatggagaccacagctcgactggagcggtaggagggcacccacgggggcctggagagtattgtcatctgcatgagcaaagagttcatcaccacatctttgcaagaggaaaaagaaaggggaagaatcatgtgtctaatgttgtaaggtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - dpy-19-like 2 pseudogene 2 (C. elegans) - thrombospondin, type I, domain containing 1 - interleukin enhancer binding factor 3, 90kDa - putative homeodomain transcription factor 2 |