Cart 12 Product Products 2 020,00 € (empty)
-
1 x MLLT6-myel...121,50 € -
1 x IGLV2-14-i...113,40 € -
1 x AHSA1-AHA1...121,50 € -
1 x FAM98C-fam...113,40 € -
1 x CLIC5-chlo...113,40 € -
-
-
1 x IGHA1-immu...121,50 € -
-
1 x EIF1AX-euk...113,40 € -
1 x IGHG2-immu...121,50 € -
1 x FLJ14107-h...113,40 €
No products
To be determined Shipping
2 020,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 020,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 020,00 €
View larger 
Data sheet of HAPLN3-hyaluronan and proteoglycan link protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HAPLN3-hyaluronan and proteoglycan link protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062320 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HAPLN3 |
| Origin species: | Human |
| Product name: | HAPLN3-hyaluronan and proteoglycan link protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC062320 |
| Gene id: | 145864 |
| Gene description: | hyaluronan and proteoglycan link protein 3 |
| Synonyms: | EXLD1; HsT19883; hyaluronan and proteoglycan link protein 3; extracellular link domain containing, 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctgttgctcctggtcccgttgctcctgctgcccggctcctacggactgcccttctacaacggcttctactactccaacagcgccaacgaccagaacctaggcaacggtcatggcaaagacctccttaatggagtgaagctggtggtggagacacccgaggagaccctgttcacctaccaaggggccagtgtgatcctgccctgccgctaccgctacgagccggccctggtctccccgcggcgtgtgcgtgtcaaatggtggaagctgtcggagaacggggccccagagaaggacgtgctggtggccatcgggctgaggcaccgctcctttggggactaccaaggccgcgtgcacctgcggcaggacaaagagcatgacgtctcgctggagatccaggatctgcggctggaggactatgggcgttaccgctgtgaggtcattgacgggctggaggatgaaagcggtctggtggagctggagctgcggggtgtggtctttccttaccagtcccccaacgggcgctaccagttcaacttccacgagggccagcaggtctgtgcagagcaggctgcggtggtggcctcctttgagcagctcttccgggcctgggaggagggcctggactggtgcaacgcgggctggctgcaggatgccacggtgcagtaccccatcatgttgccccggcagccctgcggtggcccgggcctggcacctggcgtgcgaagctacggcccccgccaccgccgcctgcaccgctatgatgtattctgcttcgctactgccctcaaggggcgggtgtactacctggagcaccctgagaagctgacgctgacagaggcaagggaggcctgccaggaagatgatgccacgatcgccaaggtgggacagctctttgccgcctggaagttccatggcctggaccgctgcgacgctggctggctggcagatggtagcgtccgctaccctgtggttcacccgcatcctaactgtgggcccccagagcctggggtccgaagctttggcttccccgacccgcagagccgcttgtacggtgtttactgctaccgccagcactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5-hydroxytryptamine (serotonin) receptor 2B - calcium and integrin binding family member 3 - 5-hydroxytryptamine (serotonin) receptor 1E - 5-hydroxytryptamine (serotonin) receptor 2A |