Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT16P-nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene Gene
PTXBC015593
New product
Data sheet of NUDT16P-nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT16P-nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015593 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT16P |
| Origin species: | Human |
| Product name: | NUDT16P-nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC015593 |
| Gene id: | 152195 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagatgcgctttgatgggcgcctgggcttccctggcggattcgtggactcgcaagacagcagcctggaggacgggctgaaccgtggtctgctggaactgctgggcgaggcggcggccgccttccgcgtggagcgccctgactaccgcagctctcacgccggatcaaggccacgtgttgtggcccacttctatgccaaatctctgacgctcgagcagctgttggctgtggaggccagcgcaacaggggccaaggaccacgggctggaggtgctgggcctggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal transducer and activator of transcription 6, interleukin-4 induced - low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) - structural maintenance of chromosomes flexible hinge domain containing 1 - solute carrier family 5 (sodium-dependent vitamin transporter), member 6 |