Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SMCHD1-structural maintenance of chromosomes flexible hinge domain containing 1 Gene
PTXBC035774
New product
Data sheet of SMCHD1-structural maintenance of chromosomes flexible hinge domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMCHD1-structural maintenance of chromosomes flexible hinge domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035774 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMCHD1 |
| Origin species: | Human |
| Product name: | SMCHD1-structural maintenance of chromosomes flexible hinge domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC035774 |
| Gene id: | 23347 |
| Gene description: | structural maintenance of chromosomes flexible hinge domain containing 1 |
| Synonyms: | structural maintenance of chromosomes flexible hinge domain-containing protein 1; SMC hinge domain-containing protein 1; structural maintenance of chromosomes flexible hinge domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttatttcttggcatctggcaagtgacatggactgtgtagtcaccctaaccactgacgctgcacgtcgtatctatgatgaaacccaaggtcgtcagcaggtgttgccccttgattctatttacaagaagactcttccagattggaaaagatctctacctcatttccgaaatggaaaattgtattttaaacccattggagatccagtctttgctcgagacttgttaacatttccagataatgtagaacattgtgaaacagtatttggtatgctgttaggagacaccattattttggataatctggatgcggccaatcattatagaaaagaggttgttaaaattacacactgtcctacactgctgaccagagatggagatcgaattcgaagtaatggaaagtttgggggccttcagaataaagctcctccaatggataaacttcggggaatggtatttggagctccagttccaaaacagtgtctgatcttaggggaacaaatagatcttcttcagcagtatcgttctgctgtgtgcaaactagacagtgtgaataaggatcttaacagtcaattagagtaccttcgcactccggatatgaggaagaaaaagcaagaacttgatgaacatgagaaaaatctcaaactaatagaggaaaaactaggtatgactcccatacgtaagtgtaatgactcattgcgtcattcaccaaaggttgagacgacagattgtccagttcctcctaaaagaatgagacgagaagctacaagacaaaataggattataaccaaaacagatgtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 5 (sodium-dependent vitamin transporter), member 6 - potassium voltage-gated channel, shaker-related subfamily, beta member 2 - solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 - ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 |