Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LRP1-low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) Gene
PTXBC045107
New product
Data sheet of LRP1-low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRP1-low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045107 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRP1 |
| Origin species: | Human |
| Product name: | LRP1-low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) Gene |
| Size: | 2ug |
| Accessions: | BC045107 |
| Gene id: | 4035 |
| Gene description: | low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) |
| Synonyms: | A2MR; APOER; APR; CD91; IGFBP3R; KPA; LRP; LRP1A; TGFBR5; prolow-density lipoprotein receptor-related protein 1; TbetaR-V/LRP-1/IGFBP-3 receptor; alpha-2-macroglobulin receptor; apolipoprotein E receptor; low density lipoprotein receptor-related protein 1; type V tgf-beta receptor; LDL receptor related protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaccccgccgttgctcctgctgctgcccctgctctcagctctggtcgcggcggctatcgacgcccctaagacttgcagccccaagcagtttgcctgcagagatcaaataacctgtatctcaaagggctggcggtgcgacggtgagagggactgcccagacggatctgacgaggcccctgagatttgtccacagagtaaggcccagcgatgccagccaaacgagcataactgcctgggtactgagctgtgtgttcccatgtcccgcctctgcaatggggtccaggactgcatggacggctcagatgaggggccccactgccgagagctccaaggcaactgctctcgcctgggctgccagcaccattgtgtccccacactcgatgggcccacctgctactgcaacagcagctttcagcttcaggcagatggcaagacctgcaaagattttgatgagtgctcagtgtacggcacctgcagccagctatgcaccaacacagacggctccttcatatgtggctgtgttgaaggatacctcctgcagccggataaccgctcctgcaaggccaagaacgagccagtagaccggccccctgtgctgttgatagccaactcccagaacatcttggccacgtacctgagtggggcccaggtgtctaccatcacacctacgagcacgcggcagaccacagccatggacttcagctatgccaacgagaccgtatgctgggtgcatgttggggacagtgctgctcagacgcagctcaagtgtgcccgcatgcctggcctaaagggcttcgtggatgagcacaccatcaacatctccctcagtctgcacctgtgtgtgttttcgaaatcacaacaggaaatggggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - structural maintenance of chromosomes flexible hinge domain containing 1 - solute carrier family 5 (sodium-dependent vitamin transporter), member 6 - potassium voltage-gated channel, shaker-related subfamily, beta member 2 - solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 |