Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPATA19-spermatogenesis associated 19 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPATA19-spermatogenesis associated 19 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058039 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPATA19 |
| Origin species: | Human |
| Product name: | SPATA19-spermatogenesis associated 19 Gene |
| Size: | 2ug |
| Accessions: | BC058039 |
| Gene id: | 219938 |
| Gene description: | spermatogenesis associated 19 |
| Synonyms: | CT132; SPAS1; spergen1; spermatogenesis-associated protein 19, mitochondrial; cancer/testis antigen 132; spergen-1; spermatogenic cell-specific gene 1 protein; spermatogenic specific-gene1; testis secretory sperm-binding protein Li 243mP; spermatogenesis associated 19 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgataattacgacatggattgtgtatattcttgctcggaaaggtgtagggcttcccttcctaccaataaccagttcggacattgacgttgtggaaagtgaggctgtgtctgtactacatcattggttgaaaaaaacagaagaagaggcttctcggggcataaaggaaaagctgtccatcaaccacccttcccagggtgtaagggagaagatgtccactgactcccctcccacccatggccaggacatccacgtgaccagagatgtggtgaagcaccacctctctaagtctgatttgttggcaaaccagagccaagaggtcctagaggagagaacacgaatccagttcataagatggagccacactcgtatcttccaagtgccaagtgagatgacagaggacatcatgcgagatcgaatagagcaggtgagacgaagcatatcccgtcttacagatgtctcagctcaggacttcagtatgagaccctcctcctcagactgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tripartite motif-containing 72 - chemokine (C-C motif) receptor 1 - G protein-coupled receptor 176 - beta-site APP-cleaving enzyme 1 |