Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TERF1-telomeric repeat binding factor (NIMA-interacting) 1 Gene
PTXBC029378
New product
Data sheet of TERF1-telomeric repeat binding factor (NIMA-interacting) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TERF1-telomeric repeat binding factor (NIMA-interacting) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029378 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TERF1 |
| Origin species: | Human |
| Product name: | TERF1-telomeric repeat binding factor (NIMA-interacting) 1 Gene |
| Size: | 2ug |
| Accessions: | BC029378 |
| Gene id: | 7013 |
| Gene description: | telomeric repeat binding factor (NIMA-interacting) 1 |
| Synonyms: | PIN2; TRBF1; TRF; hTRF1-AS; t-TRF1; telomeric repeat-binding factor 1; NIMA-interacting protein 2; TTAGGG repeat-binding factor 1; telomeric protein Pin2/TRF1; telomeric repeat binding factor (NIMA-interacting) 1; telomeric repeat binding factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaggatgtttcctcagcggccccgagcccgcggggctgtgcggatggtagggatgccgaccctactgaggagcagatggcagaaacagagagaaacgacgaggagcagttcgaatgccaggaactgctcgagtgccaggtgcaggtgggggcccccgaggaggaggaggaggaggaggaggacgcgggcctggtggccgaggccgaggccgtggctgccggctggatgctcgatttcctctgcctctctctttgccgagctttccgcgacggccgctccgaggacttccgcaggacccgcaacagcgcagaggctattattcatggactatccagtctaacagcttgccagttgagaacgatatacatatgtcagtttttgacaagaattgcagcaggaaaaacccttgatgcacagtttgaaaatgatgaacgaattacacccttggaatcagccctgatgatttggggttcaattgaaaaggaacatgacaaacttcatgaagaaatacagaatttaattaaaattcaggctatagctgtttgtatggaaaatggcaactttaaagaagcagaagaagtctttgaaagaatatttggtgatccaaattctcatatgcctttcaaaagcaaattgcttatgataatctctcagaaagatacatttcattccttttttcaacacttcagctacaaccacatgatggagaaaattaagagttatgtgaattatgtgctaagtgaaaaatcatcaacctttctaatgaaggcagcggcaaaagtagtagaaagcaaaaggacaagaacaataacttctcaagataaacctagtggtaatgatgttgaaatggaaactgaagctaatttggatacaagaaaaaggtctcacaagaatcttttcttatctaagttgcaacatggaacccagcaacaagaccttaataagaaagaaagaagagtaggaactcctcaaagtacaaaaaagaaaaaagaaagcagaagagccactgaaagcagaatacctgtttcaaagagtcagccggtaactcctgaaaaacatcgagctagaaaaagacaggcatggctttgggaagaagacaagaatttgagatctggcgtgaggaaatatggagagggaaactggtctaaaatactgttgcattataaattcaacaaccggacaagtgtcatgttaaaagacagatggaggaccatgaagaaactaaaactgatttcctcagacagcgaagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LATS, large tumor suppressor, homolog 1 (Drosophila) - similar to mitochondrial carrier triple repeat 1 - regulation of nuclear pre-mRNA domain containing 1A - calcium channel, voltage-dependent, gamma subunit 2 |