Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPTLC3-serine palmitoyltransferase, long chain base subunit 3 Gene
PTXBC020656
New product
Data sheet of SPTLC3-serine palmitoyltransferase, long chain base subunit 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPTLC3-serine palmitoyltransferase, long chain base subunit 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020656 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPTLC3 |
| Origin species: | Human |
| Product name: | SPTLC3-serine palmitoyltransferase, long chain base subunit 3 Gene |
| Size: | 2ug |
| Accessions: | BC020656 |
| Gene id: | 55304 |
| Gene description: | serine palmitoyltransferase, long chain base subunit 3 |
| Synonyms: | C20orf38; LCB2B; LCB3; SPT3; SPTLC2L; dJ718P11; dJ718P11.1; hLCB2b; serine palmitoyltransferase 3; LCB 3; SPT 3; long chain base biosynthesis protein 2b; long chain base biosynthesis protein 3; serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2); serine-palmitoyl-CoA transferase 3; serine palmitoyltransferase long chain base subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaaccctggaggtggtgctgtttgcaacgggaaacttcacaatcacaagaaacagagcaatggctcacaaagcagaaactgcacaaagaatggaatagtgaaggaagcccagcaaaatgggaagccacatttttatgataagctcattgttgaatcgtttgaggaagcaccccttcatgttatggttttcacttacatgggatatggaattggaaccctgtttggctatctcagagactttttaagaaactggggaatagaaaaatgcaacgcagctgtggaacgaaaagaacaaaaagtacgtatgcgcacctccctggatctttgtcaatgcctactcctctctaaagtgttctcagaagtggtgatgcaggtgcagattctagaaagcatgaggtgctcaggaactattcagggcaaatttcattcatctccacctgctaaaccccattacccatgggcttatggacctgtttttacaaacatctcatgggcaactactatttgccacataccaaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class F - solute carrier family 17 (sodium phosphate), member 3 - phosphatidylinositol glycan anchor biosynthesis, class K - proteasome (prosome, macropain) subunit, beta type, 10 |