Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf97-chromosome 10 open reading frame 97 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf97-chromosome 10 open reading frame 97 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020605 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf97 |
| Origin species: | Human |
| Product name: | C10orf97-chromosome 10 open reading frame 97 Gene |
| Size: | 2ug |
| Accessions: | BC020605 |
| Gene id: | 80013 |
| Gene description: | chromosome 10 open reading frame 97 |
| Synonyms: | C10orf97; CARP; DERP5; MST126; MSTP126; my042; ubiquitin carboxyl-terminal hydrolase FAM188A; CARD-containing protein; caspase recruitment domain containing pro-apoptotic protein; dermal papilla-derived protein 5; protein FAM188A; family with sequence similarity 188 member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgaactgactaaagagctgatggagctggtgtggggcaccaagagcagccccggtctctcggacaccattttctgccgctggacgcaagggtttgtgtttagtgaatcagagggatctgcattagaacagtttgaaggtggcccctgtgctgttattgcacctgttcaggcatttcttttgaagaagctcctgttttcttcggagaagtcttcttggcgggattgttcagaggaagagcagaaggaactcctttgtcataccttgtgtgatattttagaaggtgcttgttgtgaccactctggatcatactgcttggtttcatggttaagaggaaagacaactgaggaaactgctagtatttctgggagtcctgcagagtctagttgccaagtggaacattcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycoprotein hormones, alpha polypeptide - chromosome 1 open reading frame 162 - secretory leukocyte peptidase inhibitor - chromosome 11 open reading frame 30 |