Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CGA-glycoprotein hormones, alpha polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CGA-glycoprotein hormones, alpha polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020782 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CGA |
| Origin species: | Human |
| Product name: | CGA-glycoprotein hormones, alpha polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC020782 |
| Gene id: | 1081 |
| Gene description: | glycoprotein hormones, alpha polypeptide |
| Synonyms: | CG-ALPHA; FSHA; GPHA1; GPHa; LHA; TSHA; glycoprotein hormones alpha chain; FSH-alpha; LSH-alpha; TSH-alpha; anterior pituitary glycoprotein hormones common subunit alpha; choriogonadotropin alpha chain; chorionic gonadotrophin subunit alpha; chorionic gonadotropin, alpha polypeptide; follicle-stimulating hormone alpha chain; follicle-stimulating hormone alpha subunit; follitropin alpha chain; luteinizing hormone alpha chain; lutropin alpha chain; thyroid-stimulating hormone alpha chain; thyrotropin alpha chain; glycoprotein hormones, alpha polypeptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctagagcatatcccactccactaaggtccaagaagacgatgttggtccaaaagaacgtcacctcagagtccacttgctgtgtagctaaatcatataacagggtcacagtaatggggggtttcaaagtggagaaccacacggcgtgccactgcagtacttgttattatcacaaatcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 162 - secretory leukocyte peptidase inhibitor - chromosome 11 open reading frame 30 - chromosome 11 open reading frame 17 |